ID: 906678357

View in Genome Browser
Species Human (GRCh38)
Location 1:47709041-47709063
Sequence CCTGTAGAAGGAAGGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678343_906678357 19 Left 906678343 1:47708999-47709021 CCCGGGGCCAGCGCCCTAACCTT No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678349_906678357 0 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678348_906678357 5 Left 906678348 1:47709013-47709035 CCTAACCTTTCAGAGCCTGGCCC No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678350_906678357 -10 Left 906678350 1:47709028-47709050 CCTGGCCCTGCCACCTGTAGAAG No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678345_906678357 12 Left 906678345 1:47709006-47709028 CCAGCGCCCTAACCTTTCAGAGC No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678347_906678357 6 Left 906678347 1:47709012-47709034 CCCTAACCTTTCAGAGCCTGGCC No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
906678344_906678357 18 Left 906678344 1:47709000-47709022 CCGGGGCCAGCGCCCTAACCTTT No data
Right 906678357 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678357 Original CRISPR CCTGTAGAAGGAAGGCGCGC TGG Intergenic
No off target data available for this crispr