ID: 906678358

View in Genome Browser
Species Human (GRCh38)
Location 1:47709044-47709066
Sequence GTAGAAGGAAGGCGCGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678344_906678358 21 Left 906678344 1:47709000-47709022 CCGGGGCCAGCGCCCTAACCTTT No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678345_906678358 15 Left 906678345 1:47709006-47709028 CCAGCGCCCTAACCTTTCAGAGC No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678348_906678358 8 Left 906678348 1:47709013-47709035 CCTAACCTTTCAGAGCCTGGCCC No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678343_906678358 22 Left 906678343 1:47708999-47709021 CCCGGGGCCAGCGCCCTAACCTT No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678347_906678358 9 Left 906678347 1:47709012-47709034 CCCTAACCTTTCAGAGCCTGGCC No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678350_906678358 -7 Left 906678350 1:47709028-47709050 CCTGGCCCTGCCACCTGTAGAAG No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data
906678349_906678358 3 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678358 1:47709044-47709066 GTAGAAGGAAGGCGCGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678358 Original CRISPR GTAGAAGGAAGGCGCGCTGG TGG Intergenic
No off target data available for this crispr