ID: 906678359

View in Genome Browser
Species Human (GRCh38)
Location 1:47709058-47709080
Sequence CGCTGGTGGCCCGTTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678348_906678359 22 Left 906678348 1:47709013-47709035 CCTAACCTTTCAGAGCCTGGCCC No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678345_906678359 29 Left 906678345 1:47709006-47709028 CCAGCGCCCTAACCTTTCAGAGC No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678356_906678359 -6 Left 906678356 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678347_906678359 23 Left 906678347 1:47709012-47709034 CCCTAACCTTTCAGAGCCTGGCC No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678355_906678359 -3 Left 906678355 1:47709038-47709060 CCACCTGTAGAAGGAAGGCGCGC No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678349_906678359 17 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678354_906678359 1 Left 906678354 1:47709034-47709056 CCTGCCACCTGTAGAAGGAAGGC No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678352_906678359 2 Left 906678352 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data
906678350_906678359 7 Left 906678350 1:47709028-47709050 CCTGGCCCTGCCACCTGTAGAAG No data
Right 906678359 1:47709058-47709080 CGCTGGTGGCCCGTTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678359 Original CRISPR CGCTGGTGGCCCGTTCAAGC AGG Intergenic
No off target data available for this crispr