ID: 906678360

View in Genome Browser
Species Human (GRCh38)
Location 1:47709064-47709086
Sequence TGGCCCGTTCAAGCAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678349_906678360 23 Left 906678349 1:47709018-47709040 CCTTTCAGAGCCTGGCCCTGCCA No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678354_906678360 7 Left 906678354 1:47709034-47709056 CCTGCCACCTGTAGAAGGAAGGC No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678347_906678360 29 Left 906678347 1:47709012-47709034 CCCTAACCTTTCAGAGCCTGGCC No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678355_906678360 3 Left 906678355 1:47709038-47709060 CCACCTGTAGAAGGAAGGCGCGC No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678348_906678360 28 Left 906678348 1:47709013-47709035 CCTAACCTTTCAGAGCCTGGCCC No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678356_906678360 0 Left 906678356 1:47709041-47709063 CCTGTAGAAGGAAGGCGCGCTGG No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678352_906678360 8 Left 906678352 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data
906678350_906678360 13 Left 906678350 1:47709028-47709050 CCTGGCCCTGCCACCTGTAGAAG No data
Right 906678360 1:47709064-47709086 TGGCCCGTTCAAGCAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678360 Original CRISPR TGGCCCGTTCAAGCAGGCAG TGG Intergenic
No off target data available for this crispr