ID: 906678491

View in Genome Browser
Species Human (GRCh38)
Location 1:47709647-47709669
Sequence CCGCGGGGCCGCCCCTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678485_906678491 1 Left 906678485 1:47709623-47709645 CCGCGGCAGAGGGCGCGGGCTAG No data
Right 906678491 1:47709647-47709669 CCGCGGGGCCGCCCCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678491 Original CRISPR CCGCGGGGCCGCCCCTCCCC CGG Intergenic