ID: 906678708

View in Genome Browser
Species Human (GRCh38)
Location 1:47710642-47710664
Sequence CATGGGCCTGCAGCGAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678708_906678720 20 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
906678708_906678716 4 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678716 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
906678708_906678712 -3 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678712 1:47710662-47710684 ATGGCGCCCTCTTGCGTTCGTGG No data
906678708_906678721 21 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678721 1:47710686-47710708 CGGAGGCGCAGGCGGCTGCTGGG No data
906678708_906678718 13 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678718 1:47710678-47710700 TTCGTGGCCGGAGGCGCAGGCGG No data
906678708_906678717 10 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678717 1:47710675-47710697 GCGTTCGTGGCCGGAGGCGCAGG No data
906678708_906678713 1 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678713 1:47710666-47710688 CGCCCTCTTGCGTTCGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678708 Original CRISPR CATGGGCCTGCAGCGAGCCC CGG (reversed) Intergenic