ID: 906678711

View in Genome Browser
Species Human (GRCh38)
Location 1:47710660-47710682
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678711_906678721 3 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678721 1:47710686-47710708 CGGAGGCGCAGGCGGCTGCTGGG No data
906678711_906678722 21 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678711_906678717 -8 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678717 1:47710675-47710697 GCGTTCGTGGCCGGAGGCGCAGG No data
906678711_906678720 2 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
906678711_906678724 30 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data
906678711_906678718 -5 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678718 1:47710678-47710700 TTCGTGGCCGGAGGCGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678711 Original CRISPR ACGAACGCAAGAGGGCGCCA TGG (reversed) Intergenic
No off target data available for this crispr