ID: 906678713 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:47710666-47710688 |
| Sequence | CGCCCTCTTGCGTTCGTGGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906678708_906678713 | 1 | Left | 906678708 | 1:47710642-47710664 | CCGGGGCTCGCTGCAGGCCCATG | No data | ||
| Right | 906678713 | 1:47710666-47710688 | CGCCCTCTTGCGTTCGTGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906678713 | Original CRISPR | CGCCCTCTTGCGTTCGTGGC CGG | Intergenic | ||