ID: 906678715

View in Genome Browser
Species Human (GRCh38)
Location 1:47710669-47710691
Sequence CCTCCGGCCACGAACGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678715_906678720 -7 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
906678715_906678726 27 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678726 1:47710719-47710741 TCCCGCGGTCCTGCTGGACTTGG No data
906678715_906678722 12 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678715_906678724 21 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data
906678715_906678721 -6 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678721 1:47710686-47710708 CGGAGGCGCAGGCGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678715 Original CRISPR CCTCCGGCCACGAACGCAAG AGG (reversed) Intergenic