ID: 906678717

View in Genome Browser
Species Human (GRCh38)
Location 1:47710675-47710697
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678708_906678717 10 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678717 1:47710675-47710697 GCGTTCGTGGCCGGAGGCGCAGG No data
906678710_906678717 -7 Left 906678710 1:47710659-47710681 CCCATGGCGCCCTCTTGCGTTCG No data
Right 906678717 1:47710675-47710697 GCGTTCGTGGCCGGAGGCGCAGG No data
906678711_906678717 -8 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678717 1:47710675-47710697 GCGTTCGTGGCCGGAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type