ID: 906678718

View in Genome Browser
Species Human (GRCh38)
Location 1:47710678-47710700
Sequence TTCGTGGCCGGAGGCGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678710_906678718 -4 Left 906678710 1:47710659-47710681 CCCATGGCGCCCTCTTGCGTTCG No data
Right 906678718 1:47710678-47710700 TTCGTGGCCGGAGGCGCAGGCGG No data
906678711_906678718 -5 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678718 1:47710678-47710700 TTCGTGGCCGGAGGCGCAGGCGG No data
906678708_906678718 13 Left 906678708 1:47710642-47710664 CCGGGGCTCGCTGCAGGCCCATG No data
Right 906678718 1:47710678-47710700 TTCGTGGCCGGAGGCGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678718 Original CRISPR TTCGTGGCCGGAGGCGCAGG CGG Intergenic