ID: 906678719

View in Genome Browser
Species Human (GRCh38)
Location 1:47710685-47710707
Sequence CCAGCAGCCGCCTGCGCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678719_906678724 5 Left 906678719 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data
906678719_906678729 17 Left 906678719 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
Right 906678729 1:47710725-47710747 GGTCCTGCTGGACTTGGACGCGG No data
906678719_906678722 -4 Left 906678719 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678719_906678726 11 Left 906678719 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
Right 906678726 1:47710719-47710741 TCCCGCGGTCCTGCTGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678719 Original CRISPR CCAGCAGCCGCCTGCGCCTC CGG (reversed) Intergenic