ID: 906678722

View in Genome Browser
Species Human (GRCh38)
Location 1:47710704-47710726
Sequence CTGGGCTGACCCGTGTCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678714_906678722 13 Left 906678714 1:47710668-47710690 CCCTCTTGCGTTCGTGGCCGGAG No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678719_906678722 -4 Left 906678719 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678711_906678722 21 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678715_906678722 12 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data
906678710_906678722 22 Left 906678710 1:47710659-47710681 CCCATGGCGCCCTCTTGCGTTCG No data
Right 906678722 1:47710704-47710726 CTGGGCTGACCCGTGTCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906678722 Original CRISPR CTGGGCTGACCCGTGTCCCG CGG Intergenic