ID: 906678724

View in Genome Browser
Species Human (GRCh38)
Location 1:47710713-47710735
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906678714_906678724 22 Left 906678714 1:47710668-47710690 CCCTCTTGCGTTCGTGGCCGGAG No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data
906678715_906678724 21 Left 906678715 1:47710669-47710691 CCTCTTGCGTTCGTGGCCGGAGG No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data
906678711_906678724 30 Left 906678711 1:47710660-47710682 CCATGGCGCCCTCTTGCGTTCGT No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data
906678719_906678724 5 Left 906678719 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG No data
Right 906678724 1:47710713-47710735 CCCGTGTCCCGCGGTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type