ID: 906681091

View in Genome Browser
Species Human (GRCh38)
Location 1:47725825-47725847
Sequence AACCAGACAGAAGACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906681091_906681095 -10 Left 906681091 1:47725825-47725847 CCTTCCCTGTCTTCTGTCTGGTT No data
Right 906681095 1:47725838-47725860 CTGTCTGGTTGCCTCCTTCAGGG No data
906681091_906681099 4 Left 906681091 1:47725825-47725847 CCTTCCCTGTCTTCTGTCTGGTT No data
Right 906681099 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
906681091_906681100 28 Left 906681091 1:47725825-47725847 CCTTCCCTGTCTTCTGTCTGGTT No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681091_906681097 3 Left 906681091 1:47725825-47725847 CCTTCCCTGTCTTCTGTCTGGTT No data
Right 906681097 1:47725851-47725873 TCCTTCAGGGCACTGCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906681091 Original CRISPR AACCAGACAGAAGACAGGGA AGG (reversed) Intergenic