ID: 906681098

View in Genome Browser
Species Human (GRCh38)
Location 1:47725852-47725874
Sequence CCCGCTCAGCAGTGCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906681098_906681100 1 Left 906681098 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681098_906681104 21 Left 906681098 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
Right 906681104 1:47725896-47725918 CGGAGACACAGCACCGGCCGTGG No data
906681098_906681102 15 Left 906681098 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
Right 906681102 1:47725890-47725912 GCCTAACGGAGACACAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906681098 Original CRISPR CCCGCTCAGCAGTGCCCTGA AGG (reversed) Intergenic
No off target data available for this crispr