ID: 906681100

View in Genome Browser
Species Human (GRCh38)
Location 1:47725876-47725898
Sequence TGCTGCCAGCATCAGCCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906681090_906681100 29 Left 906681090 1:47725824-47725846 CCCTTCCCTGTCTTCTGTCTGGT No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681091_906681100 28 Left 906681091 1:47725825-47725847 CCTTCCCTGTCTTCTGTCTGGTT No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681096_906681100 4 Left 906681096 1:47725849-47725871 CCTCCTTCAGGGCACTGCTGAGC No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681092_906681100 24 Left 906681092 1:47725829-47725851 CCCTGTCTTCTGTCTGGTTGCCT No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681093_906681100 23 Left 906681093 1:47725830-47725852 CCTGTCTTCTGTCTGGTTGCCTC No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data
906681098_906681100 1 Left 906681098 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
Right 906681100 1:47725876-47725898 TGCTGCCAGCATCAGCCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906681100 Original CRISPR TGCTGCCAGCATCAGCCTAA CGG Intergenic
No off target data available for this crispr