ID: 906681101 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:47725881-47725903 |
| Sequence | TGTCTCCGTTAGGCTGATGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 906681101_906681104 | -8 | Left | 906681101 | 1:47725881-47725903 | CCAGCATCAGCCTAACGGAGACA | No data | ||
| Right | 906681104 | 1:47725896-47725918 | CGGAGACACAGCACCGGCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 906681101 | Original CRISPR | TGTCTCCGTTAGGCTGATGC TGG (reversed) | Intergenic | ||