ID: 906681102 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:47725890-47725912 |
Sequence | GCCTAACGGAGACACAGCAC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
906681096_906681102 | 18 | Left | 906681096 | 1:47725849-47725871 | CCTCCTTCAGGGCACTGCTGAGC | No data | ||
Right | 906681102 | 1:47725890-47725912 | GCCTAACGGAGACACAGCACCGG | No data | ||||
906681098_906681102 | 15 | Left | 906681098 | 1:47725852-47725874 | CCTTCAGGGCACTGCTGAGCGGG | No data | ||
Right | 906681102 | 1:47725890-47725912 | GCCTAACGGAGACACAGCACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
906681102 | Original CRISPR | GCCTAACGGAGACACAGCAC CGG | Intergenic | ||