ID: 906681102

View in Genome Browser
Species Human (GRCh38)
Location 1:47725890-47725912
Sequence GCCTAACGGAGACACAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906681096_906681102 18 Left 906681096 1:47725849-47725871 CCTCCTTCAGGGCACTGCTGAGC No data
Right 906681102 1:47725890-47725912 GCCTAACGGAGACACAGCACCGG No data
906681098_906681102 15 Left 906681098 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
Right 906681102 1:47725890-47725912 GCCTAACGGAGACACAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906681102 Original CRISPR GCCTAACGGAGACACAGCAC CGG Intergenic
No off target data available for this crispr