ID: 906681104

View in Genome Browser
Species Human (GRCh38)
Location 1:47725896-47725918
Sequence CGGAGACACAGCACCGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906681098_906681104 21 Left 906681098 1:47725852-47725874 CCTTCAGGGCACTGCTGAGCGGG No data
Right 906681104 1:47725896-47725918 CGGAGACACAGCACCGGCCGTGG No data
906681096_906681104 24 Left 906681096 1:47725849-47725871 CCTCCTTCAGGGCACTGCTGAGC No data
Right 906681104 1:47725896-47725918 CGGAGACACAGCACCGGCCGTGG No data
906681101_906681104 -8 Left 906681101 1:47725881-47725903 CCAGCATCAGCCTAACGGAGACA No data
Right 906681104 1:47725896-47725918 CGGAGACACAGCACCGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906681104 Original CRISPR CGGAGACACAGCACCGGCCG TGG Intergenic
No off target data available for this crispr