ID: 906681597

View in Genome Browser
Species Human (GRCh38)
Location 1:47729840-47729862
Sequence TGCTTCACAGAGTGTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906681597_906681605 29 Left 906681597 1:47729840-47729862 CCCAGCTGACACTCTGTGAAGCA No data
Right 906681605 1:47729892-47729914 ACTCTTGACCTGTGAAATCAAGG No data
906681597_906681606 30 Left 906681597 1:47729840-47729862 CCCAGCTGACACTCTGTGAAGCA No data
Right 906681606 1:47729893-47729915 CTCTTGACCTGTGAAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906681597 Original CRISPR TGCTTCACAGAGTGTCAGCT GGG (reversed) Intergenic
No off target data available for this crispr