ID: 906684184

View in Genome Browser
Species Human (GRCh38)
Location 1:47752385-47752407
Sequence GGCTGAGCCAACTCTCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906684184_906684195 30 Left 906684184 1:47752385-47752407 CCGCTGGGAGAGTTGGCTCAGCC No data
Right 906684195 1:47752438-47752460 TACCACCCCCTGCATTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906684184 Original CRISPR GGCTGAGCCAACTCTCCCAG CGG (reversed) Intergenic
No off target data available for this crispr