ID: 906686161

View in Genome Browser
Species Human (GRCh38)
Location 1:47764745-47764767
Sequence CAGAACAGGGAACAGGAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 589}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906686151_906686161 20 Left 906686151 1:47764702-47764724 CCCCAGTTTGGGTGAGATCTGCT 0: 1
1: 0
2: 1
3: 12
4: 133
Right 906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG 0: 1
1: 0
2: 5
3: 68
4: 589
906686153_906686161 18 Left 906686153 1:47764704-47764726 CCAGTTTGGGTGAGATCTGCTCC 0: 1
1: 0
2: 0
3: 11
4: 94
Right 906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG 0: 1
1: 0
2: 5
3: 68
4: 589
906686152_906686161 19 Left 906686152 1:47764703-47764725 CCCAGTTTGGGTGAGATCTGCTC 0: 1
1: 0
2: 0
3: 12
4: 96
Right 906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG 0: 1
1: 0
2: 5
3: 68
4: 589
906686155_906686161 -3 Left 906686155 1:47764725-47764747 CCCTTGCAGAGAGAACGTGGCAG 0: 1
1: 0
2: 0
3: 8
4: 130
Right 906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG 0: 1
1: 0
2: 5
3: 68
4: 589
906686156_906686161 -4 Left 906686156 1:47764726-47764748 CCTTGCAGAGAGAACGTGGCAGA 0: 1
1: 0
2: 1
3: 16
4: 221
Right 906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG 0: 1
1: 0
2: 5
3: 68
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906686161 Original CRISPR CAGAACAGGGAACAGGAGGC AGG Exonic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
901653849 1:10758045-10758067 CAGATCAGTGAAGAGCAGGCTGG - Intronic
901781638 1:11598313-11598335 CAGAGCAGGGATCTGAAGGCAGG - Intergenic
902286614 1:15411560-15411582 GGGGACAGGGAACAGGAGGTGGG - Intronic
902474221 1:16672721-16672743 AAGAACAGAGAACCTGAGGCAGG - Intergenic
902484582 1:16734721-16734743 AAGAACAGAGAACCTGAGGCAGG + Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902624279 1:17667580-17667602 CAGCTCAGGAAACAGGAGGCAGG + Intronic
902734408 1:18390664-18390686 CAGAACAGGGTTCAGAACGCCGG - Intergenic
903127822 1:21259676-21259698 CTGTCCAGGGAACACGAGGCAGG + Intronic
903331285 1:22598321-22598343 CAGGCCGGGGGACAGGAGGCAGG + Intronic
903363286 1:22790568-22790590 GAGAACAGGGATCTGGAGACAGG - Intronic
903372223 1:22843835-22843857 CAAAGAAGGGAACAAGAGGCTGG - Intronic
903382471 1:22906636-22906658 CATGACAGGGAACAGGAAGGTGG + Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
904053551 1:27655718-27655740 CAGAGGAGGAGACAGGAGGCAGG + Intergenic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
904249111 1:29209985-29210007 AAGAACTGGGGACAGGAGGCAGG + Intronic
904302525 1:29563758-29563780 AACAACAGGAAACAGGAAGCAGG - Intergenic
904428525 1:30447070-30447092 GACATCAGGGAACAGGAGGAGGG + Intergenic
904452007 1:30619313-30619335 CACATCAGGGAACAAGTGGCTGG + Intergenic
904603901 1:31688752-31688774 CAGGGCAGGGATCAGGAGGGAGG - Intronic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
904684197 1:32248762-32248784 CAGCAGAGGAAACAGGATGCTGG - Exonic
904720931 1:32508058-32508080 CAGAAGAAAGAACAGTAGGCTGG - Intronic
905588562 1:39142243-39142265 GAGATGAGGCAACAGGAGGCTGG - Intronic
905790409 1:40786331-40786353 CTGGCCAGGGGACAGGAGGCAGG - Intronic
905863306 1:41364106-41364128 GGGAAGAGGGAACATGAGGCTGG + Intronic
906192178 1:43905502-43905524 CAGGAAGGGGAACAGGAGGACGG - Intronic
906192237 1:43905718-43905740 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192357 1:43906153-43906175 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906192369 1:43906189-43906211 CAGGAAGGGGAACAGGAGGAGGG - Intronic
906306851 1:44724997-44725019 CAGGAAAGGGAACAGGAAGGTGG - Intronic
906517040 1:46445704-46445726 CAGACCAGAGATCATGAGGCCGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906958627 1:50399162-50399184 CAGAACACGAAACAGGCTGCAGG + Intergenic
907241969 1:53085895-53085917 GAGAGCAGGGGACTGGAGGCAGG + Intergenic
907469875 1:54666393-54666415 CAAAACAGGTTATAGGAGGCGGG + Intronic
907610000 1:55859666-55859688 GTGAGCAGGGAACAGGAAGCAGG + Intergenic
907781986 1:57575091-57575113 GAGAACAGGGAACAGGGTGAAGG + Intronic
908810871 1:67981189-67981211 CAGAGCAGAGAATGGGAGGCAGG + Intergenic
910368405 1:86490158-86490180 CAGAACAGGGCAGAGGAGAGGGG + Intronic
911444279 1:97971128-97971150 TAAAACAGGGATCAGCAGGCCGG + Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912630468 1:111242409-111242431 CAGAACAGGGCACAGGAGACTGG + Intronic
912865217 1:113250408-113250430 CAGAAAAGGGGAGTGGAGGCTGG + Intergenic
913179919 1:116311453-116311475 CAGAAGAGGGAAGAGCAGACTGG - Intergenic
913445652 1:118947951-118947973 CAGATCATGGAACAAGATGCTGG - Intronic
913661953 1:121012426-121012448 AAGAACAGAGAACCTGAGGCAGG - Intergenic
914013330 1:143795611-143795633 AAGAACAGAGAACCTGAGGCAGG - Intergenic
914164495 1:145165574-145165596 AAGAACAGAGAACCTGAGGCAGG + Intergenic
914651952 1:149704220-149704242 AAGAACAGAGAACCTGAGGCAGG - Exonic
915076214 1:153309793-153309815 CAGGGCAGGAACCAGGAGGCAGG + Intronic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915294102 1:154908037-154908059 CAAAAGAGAGAACAGAAGGCAGG + Intergenic
915588527 1:156858055-156858077 CAGGACAGGGCCCTGGAGGCAGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
917212240 1:172642997-172643019 AAGCACAGAGAACATGAGGCAGG + Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918126681 1:181590074-181590096 CAACATAGGGAACTGGAGGCAGG - Intronic
918613792 1:186521679-186521701 CAGAACAGGCTACAGGAATCTGG - Intergenic
919736958 1:200958690-200958712 GAGAACAGAGCACAGCAGGCGGG + Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920220192 1:204391762-204391784 CAGCACAAGGGACAGGAGGAAGG + Intergenic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920365719 1:205447470-205447492 TGGAACAGGGAGTAGGAGGCGGG + Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
922536019 1:226381521-226381543 CGGACGAGGGACCAGGAGGCTGG + Intronic
923881612 1:238110148-238110170 GAGATCAGGGAACAAGAGTCAGG - Intergenic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924739277 1:246785529-246785551 CAGGACAGGGAACGGGAGAGTGG + Intergenic
924826905 1:247549260-247549282 GAGAACAGAGATAAGGAGGCTGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063144820 10:3287482-3287504 CAGAACAACGCACAGGAGGAAGG - Intergenic
1063596785 10:7442547-7442569 CAGCACAGGAAACAGCAGGCTGG + Intergenic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1064161448 10:12950088-12950110 CAGGAAAGGGAATGGGAGGCTGG - Intronic
1064614886 10:17142666-17142688 CAGAAGAGGGAACTGAAGTCTGG - Intronic
1065361193 10:24890624-24890646 GGGAAGAGGGAACAGGAGGGAGG + Intronic
1065478158 10:26163564-26163586 AAGAATAGGGAAGAGTAGGCTGG + Intronic
1065529713 10:26656099-26656121 CAGACCAGGTAACAGGCTGCAGG - Intergenic
1065845514 10:29739557-29739579 TGGAGCAGGGATCAGGAGGCTGG - Intergenic
1065916044 10:30355778-30355800 CAGCCCAGGGATCAGGGGGCAGG - Intronic
1067533744 10:47093021-47093043 CTGAGCTGGGAACAGGAGCCAGG - Intergenic
1067657842 10:48210788-48210810 CAGAACAGCCAACATGAGGTTGG - Intronic
1069562717 10:69442034-69442056 GAGAGCAGGGGACAGGAGGAAGG + Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1072032899 10:91538318-91538340 CAGAGCTGGGAACAGGACTCTGG + Intergenic
1072421990 10:95297010-95297032 AGGAACAGGGCAAAGGAGGCAGG + Intergenic
1072503714 10:96043815-96043837 CAGAAAGGGGAACAAAAGGCCGG - Intronic
1072667696 10:97406273-97406295 GAGAAAAGGGAACTGGTGGCTGG + Intronic
1074357683 10:112800389-112800411 CAGAACAAGGCACCTGAGGCAGG + Intronic
1074829052 10:117235966-117235988 CAGAACAGGGACCCGAAGGTAGG - Intergenic
1074980816 10:118618870-118618892 TAAGACAGGGAACAGTAGGCAGG + Intergenic
1076332079 10:129677642-129677664 TAGAGCAGGGACGAGGAGGCAGG - Intronic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076776060 10:132699008-132699030 CAGGACCGAGGACAGGAGGCTGG - Intronic
1077161043 11:1113047-1113069 CACAGCAGGGAAGAGCAGGCAGG - Intergenic
1077174113 11:1180982-1181004 CAGACTGGGGGACAGGAGGCCGG - Intronic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1077540177 11:3142980-3143002 CAGAGCAGGGCAGAGGAGGCAGG + Intronic
1077540216 11:3143105-3143127 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077540230 11:3143155-3143177 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1077540236 11:3143180-3143202 CAGAGCCGGGCAGAGGAGGCAGG + Intronic
1078022405 11:7666588-7666610 CAGTCCAGGGAACAAGAGGATGG - Intronic
1078480158 11:11668548-11668570 CAGAACTGGAAACAAGAGGAAGG + Intergenic
1079343525 11:19632552-19632574 CAAAACAGGCAACAGCAGGCAGG - Intronic
1081164887 11:39796083-39796105 CAGAACAGAGAAAAGGAAACTGG - Intergenic
1081630308 11:44685043-44685065 CATTACGGGGAACAAGAGGCTGG + Intergenic
1082091881 11:48097028-48097050 CTGAATGGGGAACAGGAGGGTGG - Intronic
1082866135 11:57901749-57901771 CTGAACAGGGGTCAGGAGGGAGG + Intergenic
1082965138 11:58959372-58959394 AAGAAAAGGGAAGAAGAGGCAGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083091406 11:60202706-60202728 CAGAACAGGCACCTGGAGTCAGG - Intronic
1083146973 11:60767278-60767300 CAGAGCAGAAAACAGGAGGCAGG + Intronic
1083773933 11:64884011-64884033 CAGCAGAGGGGACAGGAGGGTGG - Intronic
1084006108 11:66324521-66324543 CACATCAGGGGTCAGGAGGCTGG + Intergenic
1084319333 11:68364768-68364790 CAGAGCAGGACACAGGAGGGTGG + Intronic
1085250606 11:75141163-75141185 CAGATGAGTGAACAGGAGGAAGG + Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085882514 11:80484666-80484688 CTGAACAGGAAACATGATGCTGG + Intergenic
1086846927 11:91761868-91761890 CAGCACAGGAAAAAAGAGGCAGG + Intergenic
1087062422 11:93993252-93993274 GCGAACAGGGAAAAGGAGGGAGG - Intergenic
1087118699 11:94550246-94550268 CAGAACTGGGAACATGATGATGG + Intronic
1087175490 11:95091269-95091291 CACACCAGTGGACAGGAGGCTGG + Intronic
1087652090 11:100879681-100879703 AAGAACAGGGTAGATGAGGCAGG - Intronic
1088828691 11:113517005-113517027 CAGGCCAGGAATCAGGAGGCAGG - Intergenic
1088841313 11:113629818-113629840 CGGAACAGAGGACAGGAGGAAGG + Intergenic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1089352251 11:117828356-117828378 CCGAAAAGGGTACAGGAGCCGGG + Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089708765 11:120299935-120299957 CAGACCACCCAACAGGAGGCTGG - Intronic
1090361745 11:126177519-126177541 CAGAAGAGGGAACCGGTGGCAGG + Intergenic
1090766282 11:129879068-129879090 GAGAAGAGGGCACAGGAGACAGG - Intronic
1091324698 11:134677484-134677506 GAGAGGAGGGAACAGGAGGTTGG - Intergenic
1091446015 12:544474-544496 CAGAAGTGGGCAGAGGAGGCAGG - Intronic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1092950417 12:13498457-13498479 CGGTACAGGGAATAGGAGGTGGG - Intergenic
1094144502 12:27214397-27214419 CAGAGCAGGGCAGAGGAGGTAGG + Intergenic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096780828 12:53991223-53991245 GAGCACAGGGAACAAGAGGCTGG - Intronic
1097023440 12:56036490-56036512 AAGAACAGGGCCCAGGAGCCCGG - Exonic
1097183564 12:57184498-57184520 CATCACAGGGAACAGGAGCCTGG - Intronic
1097287129 12:57886993-57887015 GAGAACAGGGAAGAGAAGGAGGG + Intergenic
1099465880 12:82987606-82987628 CAGAGCAGTGAACAGCAGGCAGG + Intronic
1100471370 12:94896328-94896350 CAGAATAGGGAAGGGGTGGCAGG + Intergenic
1101041213 12:100757704-100757726 AAGAACAAAGAACAGTAGGCAGG - Intronic
1101241428 12:102843423-102843445 TTGAACAGGGACCAGGTGGCAGG + Intronic
1101883381 12:108641150-108641172 CAAAACAGGGAACAGGCGGTTGG + Intergenic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103530296 12:121596439-121596461 CAGAACAGGGAACAAGGGGCCGG - Intergenic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103561457 12:121795142-121795164 CAGAGCTGGGAAGGGGAGGCCGG + Intronic
1104982328 12:132579047-132579069 CAGAGGAGGGAAGGGGAGGCGGG - Intronic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1105984372 13:25550736-25550758 GAGAACTGGGAACAAGAAGCAGG - Intronic
1106123586 13:26882095-26882117 CTGATCAGGGAACCGGAGGATGG + Intergenic
1106264744 13:28100244-28100266 GAGAAGAGGGAAGAGGACGCGGG + Intronic
1106333016 13:28756483-28756505 CAGCAGAGGAAAGAGGAGGCTGG + Intergenic
1108431292 13:50356643-50356665 CACAACAGGCATCAGGAGGAAGG + Intronic
1108552988 13:51565049-51565071 CCGAACTGGCAACAGAAGGCTGG - Intergenic
1110580813 13:77122727-77122749 CAGAACAGGGAACTACAGACAGG + Intronic
1112257692 13:97849958-97849980 AAGAACAGGGAACGGGACCCTGG + Intergenic
1112838640 13:103548066-103548088 GTGGACAGGAAACAGGAGGCTGG - Intergenic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114744416 14:25132563-25132585 CAGGAAAGTGAATAGGAGGCTGG + Intergenic
1115006901 14:28496721-28496743 CTGTACAGGAAACATGAGGCTGG - Intergenic
1115287489 14:31731904-31731926 TTGAAAAGGGAACTGGAGGCCGG + Intronic
1115968247 14:38916010-38916032 CAGCACAGGGACCATGGGGCTGG + Intergenic
1118746697 14:68779246-68779268 TAGAACGGTGAACAGGAGGCTGG + Intergenic
1119018587 14:71085298-71085320 AAGAACAAGAAACAGGTGGCTGG - Intronic
1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG + Intergenic
1120848536 14:89147695-89147717 CTGTACAGGGAGCATGAGGCTGG + Intronic
1120864282 14:89282599-89282621 CAAAGCAGGGAACAGCAAGCTGG + Intronic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1121525145 14:94614337-94614359 CAGGACAGGGACCAGGACGCAGG + Exonic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1122094626 14:99362064-99362086 AAGAACAGGGCAGAGGAGTCAGG - Intergenic
1122270212 14:100565619-100565641 CAGTCCAGGGGCCAGGAGGCAGG + Intronic
1122411394 14:101527813-101527835 CAGGACACGGAACAGGTAGCAGG + Intergenic
1122415735 14:101548693-101548715 CTGGAGAGGGAAGAGGAGGCGGG + Intergenic
1122781786 14:104146838-104146860 CAGGCCAGGTGACAGGAGGCGGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1122997191 14:105271648-105271670 CAGCACAGAGCAGAGGAGGCTGG + Intronic
1123072419 14:105648212-105648234 CTGAACAGGCTACAAGAGGCTGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1123694103 15:22864448-22864470 CATAACAGAGGACAGCAGGCCGG - Intronic
1123999428 15:25742464-25742486 CAGAAAAGGCAAGGGGAGGCTGG - Intronic
1124217446 15:27819352-27819374 CATAACATGTCACAGGAGGCAGG + Intronic
1125844447 15:42838520-42838542 AAGAACAGGGAACAGGCTGGGGG + Intronic
1126346246 15:47697256-47697278 CAGAACAGAGAACTGCAGGAAGG + Intronic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1128391156 15:67183536-67183558 CAGTAGTGGGAATAGGAGGCAGG + Intronic
1128557712 15:68642860-68642882 CACAGCAAGGAACAGGAGGTTGG + Intronic
1129178455 15:73856731-73856753 CCCAGCAGGAAACAGGAGGCTGG + Intergenic
1129263390 15:74381381-74381403 CAGAAAGGGGCACAGGAGCCAGG + Intergenic
1129514905 15:76151456-76151478 CAGAACAGGGCCCTGGAGGGTGG - Intronic
1129910545 15:79222633-79222655 AAGAACAGGGAATGGGAAGCTGG - Intergenic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130819456 15:87479090-87479112 CAGAACAGAGCACAGGAGGGAGG - Intergenic
1130832724 15:87617873-87617895 CATAGCAGAGAACAGGAGGCAGG - Intergenic
1130961218 15:88659734-88659756 CAGAACACTGGACAGGAAGCTGG - Intergenic
1131109845 15:89758389-89758411 GGGGACAGGGAAGAGGAGGCTGG - Intergenic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1132114107 15:99123501-99123523 AAGACCAGGGAACAGAAGGGAGG - Intronic
1132765282 16:1531410-1531432 CAGAACAGGGACACGGAGGGAGG - Intronic
1132929573 16:2451945-2451967 CAGAACAGGCAACAGGCCGTTGG - Intronic
1133558319 16:6926433-6926455 CTGAACACCGATCAGGAGGCAGG - Intronic
1133624911 16:7562317-7562339 AACTACAGGGAACAGGCGGCAGG - Intronic
1135239604 16:20792742-20792764 CAGAAGTGGGAACCAGAGGCTGG + Intronic
1135589495 16:23694982-23695004 AAGGACAGGGAGCGGGAGGCAGG + Intronic
1137365768 16:47858224-47858246 CACAACAGGGAAGCAGAGGCAGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139910393 16:70394089-70394111 GTGAACAGGGAATAGGGGGCAGG - Intronic
1140779598 16:78282578-78282600 TAGAACAGGGAAAATGTGGCCGG + Intronic
1141147209 16:81539635-81539657 GAGAAAAGGAAACAGGACGCAGG - Intronic
1141157129 16:81605172-81605194 CAGAACAGTGCACGGGATGCTGG + Intronic
1141503421 16:84460153-84460175 CAGAAGTGGGACCAGGAAGCTGG + Intronic
1142246546 16:88972799-88972821 CAAAAGGGGGGACAGGAGGCGGG + Intronic
1142429083 16:90016748-90016770 CACAACAGGGAACAGGATTTGGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143289542 17:5818429-5818451 CAGAACAGGGAACAGGGACAAGG - Intronic
1143890873 17:10101490-10101512 CACAAGAGTGACCAGGAGGCAGG + Intronic
1144682483 17:17205111-17205133 CACAAAAGGCAACAGCAGGCTGG + Intronic
1144711265 17:17403251-17403273 CAGACTAGGGAACACAAGGCTGG + Intergenic
1145247644 17:21280079-21280101 CAGCACAGAGAAGAGGAGGCTGG + Intergenic
1145802332 17:27696079-27696101 CGGAAAGGGGAACAGGAGACAGG - Intergenic
1145871219 17:28275049-28275071 CATGACAGGGAACAGGGGACAGG + Intergenic
1145871220 17:28275056-28275078 GGGAACAGGGGACAGGAAGCAGG + Intergenic
1146122909 17:30210703-30210725 CAGGACAGTGAACAGGAGGGAGG + Intronic
1146935471 17:36810081-36810103 CAGAAGAGGGGACCTGAGGCCGG + Intergenic
1147747289 17:42702599-42702621 CAGAGCAGGGAAGAGGAACCAGG + Intronic
1148051348 17:44771552-44771574 CAGAACAGTGAGCAGAACGCTGG - Intronic
1148076837 17:44942012-44942034 CTGAACAGGGACCAGGACCCAGG - Intronic
1148317301 17:46713324-46713346 CAAAACAGGGAAGGGAAGGCAGG + Intronic
1148349719 17:46931782-46931804 GAGAACAGGGGACAGGAAGCAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149302529 17:55318303-55318325 CAGAAGAGGATACAGAAGGCAGG - Intronic
1150464623 17:65381558-65381580 CAGAAAAGAGAAAATGAGGCAGG + Intergenic
1151363216 17:73600889-73600911 CCCACCAGGGAACAGGAGGCAGG + Intronic
1151856705 17:76726852-76726874 CAGAACTGGCAACGGGCGGCTGG - Exonic
1151979486 17:77500025-77500047 CAAGACAGGTAACAGGAAGCAGG - Exonic
1152301376 17:79496957-79496979 CAGAACAGGGGTCCCGAGGCAGG - Intronic
1152329831 17:79666192-79666214 CTGAACAGGTAACAGGTGCCTGG + Intergenic
1152632806 17:81418101-81418123 CAGAAGAGGCAACAGTAAGCAGG + Intronic
1152635576 17:81429323-81429345 CAGAGCAGGGGACAGCAAGCTGG - Intronic
1153497545 18:5715418-5715440 CAGAAAAGGGAAGAGTTGGCAGG + Intergenic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1155525645 18:26713769-26713791 AAGAATAGGGACCAGGAGACAGG + Intergenic
1156580355 18:38367875-38367897 GAGAACAAGGAACATAAGGCAGG + Intergenic
1156945937 18:42831628-42831650 AAGAAGAGAGAACTGGAGGCAGG + Intronic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157940129 18:51919187-51919209 CAGGACTGGGAACAGGGAGCTGG - Intergenic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1158888230 18:61848995-61849017 GAGAACAGGGAAGGGGAGCCTGG + Intronic
1159956370 18:74521200-74521222 CAGGGCAGGGGACAGCAGGCAGG + Exonic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160730906 19:641278-641300 CAGAACAGTGAACGGTTGGCCGG + Intronic
1160926287 19:1547788-1547810 CCAACCAGGGAAGAGGAGGCAGG - Intergenic
1161535317 19:4815838-4815860 CGCAAAAGGGAACAGGAAGCGGG - Intergenic
1161572530 19:5038337-5038359 CAGAGGAGGGAACATGAGGCTGG + Intronic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162516155 19:11149081-11149103 CAGAAAAGGATATAGGAGGCTGG + Exonic
1162534214 19:11253530-11253552 CAGGACAGGCCACAGGAGGGAGG + Intronic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1162956667 19:14102660-14102682 GAGATCAGGGGACAGGAGTCAGG - Intronic
1163114306 19:15180033-15180055 CAGGAGAGGGAAGAGGAGGTGGG - Intronic
1163505440 19:17703249-17703271 CAGCACAGGGAATTGGAGGAAGG + Intergenic
1163786294 19:19276685-19276707 CAAAACAGATAACAGGAGGAGGG + Intronic
1164557182 19:29262688-29262710 CAGATCAGGACACAGGAGGATGG + Intergenic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1164809092 19:31141827-31141849 CCCAACAGGGAACATGAGGAAGG - Intergenic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1165656117 19:37533684-37533706 CACAACAGAGAATAGGAAGCAGG - Intronic
1166398882 19:42463162-42463184 GATAATAGGGAAGAGGAGGCAGG + Intergenic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1167113257 19:47474117-47474139 CAGAACGGAGCACAGGAGGCCGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167270187 19:48501971-48501993 CAGGAGAGGGAAGAGGAGCCAGG - Intronic
1167360848 19:49029669-49029691 GGAAACAGGGAAAAGGAGGCTGG - Intronic
1167944511 19:52977304-52977326 CAGAACAGCGGACAGGAAGGTGG + Intergenic
1168137303 19:54360204-54360226 CGGGGCAGGGGACAGGAGGCTGG + Intronic
1168160774 19:54508881-54508903 CGGGGCAGGGGACAGGAGGCTGG - Intronic
1168353437 19:55688817-55688839 CAGACCAGGGAACGAGAGACAGG - Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
1168649914 19:58086360-58086382 CAGTACAGAGAAGAGGAGGTGGG - Intronic
1202707598 1_KI270713v1_random:35125-35147 AAGAACAGAGAACCTGAGGCAGG - Intergenic
925578913 2:5389903-5389925 CAGAAGTGGGAACAGGAGCAGGG - Intergenic
926043532 2:9693250-9693272 CTGGACAGGCATCAGGAGGCTGG + Intergenic
926555590 2:14354240-14354262 CAGGGCAGGGAAGGGGAGGCAGG + Intergenic
927096696 2:19752668-19752690 CTTAACAGGGACCAGGACGCTGG - Intergenic
927708207 2:25310159-25310181 CAGAACTGAGAACAGGGGCCTGG + Intronic
927765874 2:25807838-25807860 AAGAAGAGGGAACAGAAGCCAGG - Intronic
927857174 2:26535054-26535076 CTGAACAGGGAATGGGAGGGTGG + Intronic
928655554 2:33447262-33447284 TAGCCCAAGGAACAGGAGGCTGG + Intronic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
932132450 2:69200156-69200178 CAGATCTGGCATCAGGAGGCCGG + Intronic
932298679 2:70647719-70647741 CAGAATAGTGTACAGGAGCCCGG - Intronic
932620847 2:73264242-73264264 CACAGCAGGGCACAGAAGGCAGG + Intronic
932880524 2:75497551-75497573 CATAAAAGGGAACACCAGGCTGG + Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
934042940 2:88145037-88145059 CAGAACAGAGGTCAGGAGCCCGG + Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937216899 2:120318668-120318690 TGGAACAGAGAACAGGATGCAGG + Intergenic
938169218 2:129059884-129059906 CAGCACAGGAGACTGGAGGCAGG - Intergenic
938657585 2:133450218-133450240 CAGAACAGGGAAGATTAGCCTGG - Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939619011 2:144395292-144395314 CAGAAAAGGGAATATGAGCCAGG - Intronic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941747666 2:169104083-169104105 TAGCACAGCGAAAAGGAGGCTGG + Intergenic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
941915163 2:170807621-170807643 CAGAAAAGTGAACATGAGGAAGG + Intergenic
942242920 2:173980193-173980215 CTGAACAGGAAACAGGAGCCTGG + Intergenic
943001038 2:182329194-182329216 GAGCACAGGGAATAGGAGGTTGG - Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943540562 2:189208777-189208799 CAGAACAGGGTACAGAAGTATGG - Intergenic
943706612 2:191041839-191041861 CAGACCTGGGCACAGGAGGGAGG + Intronic
944969720 2:204978151-204978173 CAGAACAGGGCATAGAAGACTGG + Intronic
945179126 2:207074061-207074083 CTGAACAGGAAACAGGTGTCAGG - Intergenic
946054915 2:216892710-216892732 CTTAACAGGGAAAAGGATGCAGG + Intergenic
946127657 2:217578107-217578129 CAGAACAGGGTCCAGGACCCTGG + Intronic
946587041 2:221201317-221201339 TAGAGCAGGGAACAGGAGATGGG + Intergenic
947016505 2:225626409-225626431 CAGAACAGGACACAGGAGGATGG + Intronic
947197896 2:227586885-227586907 CAGCACAGTGAAAAGAAGGCAGG + Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947423292 2:229960058-229960080 CAGAAAAGGGTACAGGAAACAGG - Intronic
947818534 2:233054533-233054555 CAGAACAGGGAAGGGGTGGAGGG + Intergenic
947875738 2:233467300-233467322 CAGCACAGGGACCAAGAGGGAGG - Intronic
948002503 2:234579920-234579942 CAGAATGGGGAACAGGGGACAGG + Intergenic
948130401 2:235596524-235596546 CAGACCAGGGACCAGCAGCCGGG - Intronic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948216993 2:236239455-236239477 CAGAACTGGGACCAGAGGGCGGG - Intronic
948217009 2:236239534-236239556 CAGAACTGGGACCAGAGGGCGGG - Intronic
948251901 2:236536132-236536154 CATATCAGGGAACAGGAGCAGGG + Intergenic
948385781 2:237579726-237579748 CTAGACAGAGAACAGGAGGCTGG + Intronic
948385784 2:237579745-237579767 CTGGACAGAGAACAGGAGGCTGG + Intronic
948444268 2:238019953-238019975 AAGAGAAGGGAACAGGAGGCTGG - Intronic
948649471 2:239431581-239431603 CAGAGCATGGAACTGGAGGTAGG - Intergenic
948844042 2:240674738-240674760 CACAGCAGGGAAGAGGAGCCAGG + Intergenic
948849768 2:240699897-240699919 CACAGCAGGGAAGAGGAGCCTGG - Intergenic
948892308 2:240913404-240913426 CAGAACAAGGAACTCGAGGAGGG - Intergenic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1169118014 20:3079087-3079109 AAGAACAAGTAATAGGAGGCTGG - Intergenic
1169135038 20:3192088-3192110 CAGGACAGGGCCCATGAGGCAGG - Intronic
1169135181 20:3192953-3192975 CAAAACAGGGATCAGGCAGCGGG + Intronic
1169206057 20:3740920-3740942 CAGAGCAGGGACCAGGTGGTGGG + Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1170894247 20:20399660-20399682 CAGCACAGGAAACAAGAGGCTGG + Intronic
1171154853 20:22862526-22862548 CAGAAAAGTGAACAGGTGACAGG + Intergenic
1171975997 20:31595144-31595166 CAGAACAATGGACGGGAGGCTGG - Intergenic
1172117894 20:32583083-32583105 CCGGACCGGGAACAGGGGGCCGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1173483544 20:43422986-43423008 GGGAACAGGGAACAGGAAACAGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174510274 20:51046067-51046089 CTGAACATGGAACAGAAGCCAGG - Intergenic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1175118120 20:56697940-56697962 CTGAACACGAAACAGCAGGCAGG + Intergenic
1175125832 20:56750829-56750851 CAGGTCAGGGAACAGGTGGAGGG - Intergenic
1175199808 20:57269029-57269051 CAGAGCAGGGAACAGAAACCAGG + Intergenic
1175443373 20:59005650-59005672 CAGCACAGGGTCCAGGAGCCTGG - Intronic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176297966 21:5084530-5084552 GAGGGCTGGGAACAGGAGGCAGG + Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178876724 21:36419758-36419780 CAGACCAGGGAAGAAGGGGCTGG - Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179859063 21:44177419-44177441 GAGGGCTGGGAACAGGAGGCAGG - Intergenic
1180136926 21:45867993-45868015 CTGAAGAGGCCACAGGAGGCTGG + Intronic
1181129644 22:20723314-20723336 AAAAAAAGGGAACAGTAGGCCGG - Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181459888 22:23079646-23079668 GAGCACAGGGCACAGGGGGCTGG + Intronic
1181806046 22:25375062-25375084 CAGAGCAGGACACAGGAGGGTGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1181901411 22:26159395-26159417 GAGAACATGGAACAGGAGCTGGG + Intergenic
1182143325 22:27981170-27981192 AATAAAAGGGAACAGGAGCCTGG + Exonic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183819570 22:40334496-40334518 CAGAACAGGGATGAGGTGGGTGG - Exonic
1184097304 22:42323452-42323474 CAGCTGAGGGAACAGGAGGACGG + Intronic
1184177598 22:42797847-42797869 CAGTCCTGGGATCAGGAGGCAGG + Intronic
1184279648 22:43429709-43429731 TAGCACAGGGAATAGGAAGCAGG + Intronic
1184499159 22:44861546-44861568 CAGAGCAGAGAACTGGAGGGAGG - Intronic
1184610398 22:45599535-45599557 CAGAACTGGGCACAGGGGGTTGG + Intronic
1184692070 22:46121966-46121988 CAGCAGAGGGAACAGCAGCCAGG + Intergenic
1185047550 22:48536683-48536705 CAGCACAGGGCACAGGGAGCCGG - Intronic
950181879 3:10919092-10919114 TAGAACAGGGAAAGGGAGGGAGG - Intronic
950517406 3:13476359-13476381 CAGTACTGGGGACAGGAGGCAGG + Intergenic
950954349 3:17035562-17035584 CAAAAGTGGGAACAGGAAGCAGG - Intronic
951476959 3:23117450-23117472 CAGAAAAGGGAACAAAAGCCAGG - Intergenic
952161096 3:30694111-30694133 TAGGAATGGGAACAGGAGGCAGG - Exonic
952525241 3:34203155-34203177 TATAACAGAGAACAGGAGGGTGG + Intergenic
952644624 3:35639988-35640010 CAGAAGAGCAGACAGGAGGCGGG + Intronic
953230638 3:41062047-41062069 CAGAGAAGGGAACAAGAGACAGG - Intergenic
953737445 3:45508497-45508519 CAGAACAAGGAAGAAGAGGAAGG + Intronic
953782149 3:45880703-45880725 CAGCAGAGGGAACAGTTGGCAGG - Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954280113 3:49571280-49571302 CAGGACAGGGAAGAGGAGCCTGG + Intronic
954436810 3:50500588-50500610 CATAACTGGAAAAAGGAGGCAGG + Intronic
954872461 3:53778092-53778114 CAGGGCAGGGAACATGAGTCTGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
956540878 3:70338389-70338411 CAGAAGAGTTAACAGCAGGCAGG + Intergenic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
959613611 3:108322487-108322509 CAGAAGAGGAAAGAGGAGGTGGG - Intronic
960591556 3:119371302-119371324 AATAACAGGGAACAGGAGAGGGG - Intronic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961529899 3:127534042-127534064 CAGGGCAGGGATCAGGAGACAGG - Intergenic
961550632 3:127668795-127668817 AAGGATGGGGAACAGGAGGCAGG + Intronic
961602974 3:128075381-128075403 CCGGAAAGGGAACAGGAGGCAGG + Intronic
961749009 3:129084756-129084778 CAGCACATGGCAGAGGAGGCCGG - Intergenic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
962315409 3:134356521-134356543 CAAAACAGTGCCCAGGAGGCTGG - Exonic
962436434 3:135371436-135371458 AAGGCCAGGGAACAGGAGGGAGG - Intergenic
962607383 3:137044220-137044242 AAGAACTGGGACCTGGAGGCTGG + Intergenic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
962880948 3:139575867-139575889 CAAAACAGGGATCTGCAGGCTGG - Intronic
962902002 3:139769548-139769570 CAGGTCAGAAAACAGGAGGCAGG + Intergenic
962958459 3:140288114-140288136 CAGAACAGGAAACCGGCGGGGGG + Intronic
963052544 3:141154237-141154259 CAGAGCAGGGCAGAGGAGGAGGG + Intergenic
966891184 3:184408817-184408839 CAGAGTAGGAGACAGGAGGCAGG - Intronic
966891982 3:184413779-184413801 GAAAGCAGGGAAGAGGAGGCCGG - Intronic
967009967 3:185423529-185423551 AAGAACAGGGGAGGGGAGGCTGG + Intronic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
968441562 4:626969-626991 CAGAAAAGGGGAGAGGAAGCTGG - Intronic
968610758 4:1555936-1555958 CAGAACAGTGACCACGAGGAGGG + Intergenic
968610799 4:1556126-1556148 CAGAACAGTGACCACGAGGAGGG + Intergenic
968623090 4:1613104-1613126 GAGAACAGAGAACAGAAAGCAGG + Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969055701 4:4401386-4401408 CAGGAGAGGGAACACGAGCCCGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969721403 4:8894554-8894576 CAGAACAGGAGACAGGAGGAGGG - Intergenic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
969826774 4:9764051-9764073 CCGAGGAGGGAACAGGAGCCTGG + Intergenic
969936517 4:10687517-10687539 CAGGAAAGGGAAGAGGAGGGAGG + Intergenic
970910132 4:21265217-21265239 CAGCACAGGCAAAAGCAGGCAGG + Intronic
972572932 4:40327219-40327241 CAGAACAGGGCAGAGGATGGGGG + Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
972760870 4:42102687-42102709 CAGAAAAGAAAACTGGAGGCTGG + Intergenic
973820735 4:54659298-54659320 GAAAAAAGGGAACGGGAGGCAGG - Intronic
975817701 4:78236152-78236174 GAGAACAGGAAAGAGGAGGCTGG + Intronic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
977830945 4:101592054-101592076 CAGGACAGGCAACAGGGGGAAGG - Intronic
981169841 4:141609024-141609046 CAGAACTGGGAAAAGGATGGAGG + Intergenic
981513377 4:145581663-145581685 CAGAAGAGAGTACAGGAGCCAGG - Intergenic
982381990 4:154759032-154759054 CAGAACAGGGAATAAGTGTCAGG - Intergenic
983526697 4:168767311-168767333 CAGAACAGGGGAGAAGTGGCTGG - Intronic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990503359 5:56419743-56419765 CAGAAAAGAGAATAGGAAGCAGG - Intergenic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
992441528 5:76801512-76801534 GAGAACTGGGAAAGGGAGGCTGG + Intergenic
995069154 5:107898320-107898342 GAGTACAGGTAAGAGGAGGCAGG - Intronic
995497035 5:112757435-112757457 CAAAAAAGGCAAAAGGAGGCTGG + Intronic
995607843 5:113877123-113877145 CTGAATAGAGAACAGGAGGTAGG + Intergenic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996630797 5:125629809-125629831 CAGCCCAGGGAAGAGGAGGCTGG + Intergenic
997045545 5:130312524-130312546 AAGATTAGGGAACTGGAGGCTGG - Intergenic
997721818 5:136084129-136084151 CAGAACAGGGACCAAGATGGAGG + Intergenic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
998099468 5:139419972-139419994 GAGAGGAGGGATCAGGAGGCTGG + Intronic
998383318 5:141741460-141741482 CAGAACTGGGGCCAGGGGGCTGG - Intergenic
999495663 5:152094320-152094342 CAGATCAGTAAACAGGAGACTGG - Intergenic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000074654 5:157773670-157773692 AAAAACAAGAAACAGGAGGCTGG + Intergenic
1001548833 5:172587415-172587437 CAGAAAAGGGAAGAGGCAGCTGG + Intergenic
1001810526 5:174624259-174624281 CAGTACAGGTGACAGGAGGCAGG + Intergenic
1001971216 5:175956498-175956520 CAGGACAGGGGACAGGTGGGGGG - Intronic
1002246226 5:177887279-177887301 CAGGACAGGGGACAGGTGGGGGG + Intergenic
1002455033 5:179341223-179341245 CAGAAAAGGAAAGAAGAGGCCGG + Intronic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1003947800 6:11091273-11091295 CAGACGAGTGAACAGGAGTCAGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083603 6:21981431-21981453 CAGAGCAGAAAAGAGGAGGCAGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1006602600 6:35235824-35235846 CATGACAGGGAAGATGAGGCTGG - Intronic
1007169661 6:39853668-39853690 GAGACTAGGGAACAAGAGGCTGG + Intronic
1007464433 6:42041983-42042005 GAGAACAGAGAACAAGAGGGAGG + Intronic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1008881621 6:56386009-56386031 CATAACAGGGAAGCTGAGGCAGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010386962 6:75291231-75291253 AATAACAGGGAAAAGGAGACAGG + Intergenic
1011700426 6:89950265-89950287 CAGGACAGGGGCCAGGAGGTAGG - Exonic
1012345379 6:98179290-98179312 CAGGAAGGGGAACAGGAGACAGG + Intergenic
1013477460 6:110522034-110522056 TTTAAAAGGGAACAGGAGGCCGG - Intergenic
1014796204 6:125727690-125727712 CTGACCAGTGAACATGAGGCGGG + Intergenic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1015582281 6:134738650-134738672 CAGGACAGTGAAAAGGAGGTAGG - Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016625295 6:146159804-146159826 CAGAACAAGGCTCAGGAGGGAGG + Intronic
1016795685 6:148114756-148114778 CAGAGCAGGGAACAGAGGTCTGG + Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017128736 6:151090292-151090314 CAGCACAGGGAAAGGGAGACTGG - Intronic
1017450797 6:154552693-154552715 CAGAAAAGGGAACAGGATGTGGG - Intergenic
1017547767 6:155469973-155469995 CAGAGCAGGCAAGAGGAGACGGG + Intergenic
1017759450 6:157556723-157556745 TGGAACAGGGGACACGAGGCTGG + Intronic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018561596 6:165106007-165106029 AAAAACAGGGAACAGGGAGCTGG + Intergenic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1019117338 6:169775546-169775568 CTGAACATGGAACGAGAGGCAGG + Intronic
1019152540 6:170018592-170018614 CAGAACCCGGAACAGGGGGGAGG + Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019877216 7:3824510-3824532 CACAACAGCAAACAAGAGGCGGG - Intronic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1022991663 7:35714627-35714649 AAGAGAAGGCAACAGGAGGCAGG + Intergenic
1023109354 7:36794124-36794146 TGGTACAGGGTACAGGAGGCCGG - Intergenic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1023860993 7:44217699-44217721 CAGAATGGGGAACAGGACACAGG - Exonic
1024081962 7:45863624-45863646 CAGCACAGGGAAGACGAGGATGG + Intergenic
1024132392 7:46367602-46367624 CAAATCAGGAAAGAGGAGGCTGG - Intergenic
1024215675 7:47246256-47246278 AAGTACAGGGAAGAGGAGGCAGG + Intergenic
1025974612 7:66359752-66359774 CAGATCAGGGGCCAGGAGGATGG - Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029481226 7:100814124-100814146 CAGTACAGGGGACAGGTGGAGGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1031999693 7:128256742-128256764 CATAACAGCCAACAGGTGGCAGG + Exonic
1032018516 7:128394097-128394119 AAGGACAAGGAACAGGGGGCTGG + Intronic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032517162 7:132515212-132515234 GAGAGCAGGGGACAGGAGCCTGG + Intronic
1032545982 7:132742988-132743010 AACAACAGGGAACAGGATCCTGG + Intergenic
1033266964 7:139895060-139895082 AAGAACAGGAAACAGGATTCTGG + Intronic
1033343129 7:140507257-140507279 CAGATGGGGGAACAGGAGGCCGG + Intergenic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034468226 7:151242262-151242284 CAGAACAGGGACGAGGTGGGAGG + Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034498086 7:151433794-151433816 CAGGACAGGGGACAGCAGGATGG - Intronic
1034953017 7:155313702-155313724 AAGGACAGGGAACAGGCGGTAGG - Intergenic
1035019840 7:155794387-155794409 CAGAACTGGGAAGAGGTGCCAGG + Intergenic
1035029518 7:155848385-155848407 GAGAATAGGAGACAGGAGGCTGG - Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035777088 8:2196412-2196434 CGGAACACTGACCAGGAGGCTGG - Intergenic
1035862744 8:3047373-3047395 CAGGACATGAAACAGAAGGCCGG - Intronic
1035938426 8:3868536-3868558 CAGAACAGGGTTCAGGCTGCAGG - Intronic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036640302 8:10579459-10579481 GAGAACTGAGAGCAGGAGGCAGG + Intergenic
1036747319 8:11419090-11419112 CAGAATAGGGGACTTGAGGCTGG + Intronic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037130641 8:15404344-15404366 CACAACAGGGTACAGGAAGGTGG + Intergenic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1037424420 8:18740162-18740184 CAGACCTGGGAACAGAAGACAGG - Intronic
1037577344 8:20220053-20220075 GAGAAGAGGGAAGAGGCGGCTGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038339709 8:26675042-26675064 AGAAACAGGCAACAGGAGGCCGG - Intergenic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1038558021 8:28541759-28541781 CAGAACTGGGAACGCGATGCAGG - Intronic
1038612189 8:29067921-29067943 CAGCAGAGGGGACAGGGGGCAGG - Exonic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1040291194 8:46125915-46125937 CAGTAAAGGGGACAGTAGGCTGG - Intergenic
1040375000 8:46816502-46816524 CATAACAGGGAACAGCAACCAGG + Intergenic
1043095681 8:75968416-75968438 CAGAAAAGGGAACAAGAGAAGGG - Intergenic
1044434781 8:92149018-92149040 CAGAACAGAGCTGAGGAGGCTGG + Intergenic
1044743727 8:95352566-95352588 CAGGACAGGGATCCTGAGGCAGG + Intergenic
1045167980 8:99628456-99628478 AGGAAAAGGGAACAGGAGGCAGG - Intronic
1045352344 8:101353200-101353222 CAACACAGGGACCAGGTGGCAGG + Intergenic
1046213232 8:111107302-111107324 CAGAGCAGGGAATAGGATGATGG - Intergenic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1047089899 8:121562168-121562190 CAGAAGAGGCTACAGGGGGCAGG + Intergenic
1047206406 8:122805823-122805845 CAGAGCAGAGAACTCGAGGCAGG - Intronic
1047522559 8:125606448-125606470 CAGACCAGGGGACTGGGGGCAGG - Intergenic
1047643283 8:126843742-126843764 CAGACCAGGGAGCAAGGGGCTGG - Intergenic
1047861697 8:128974180-128974202 CAGAACAGGGAAACTGAGTCTGG - Intergenic
1048006365 8:130422449-130422471 CAGCCCAGGGAGCAGGAGCCAGG - Intronic
1048745796 8:137613771-137613793 CAGAAAGGGGAACAGGAAGCAGG - Intergenic
1048761916 8:137804679-137804701 CATAACAGAGAATAGCAGGCTGG - Intergenic
1048866223 8:138763727-138763749 CAGCGGAGGGAATAGGAGGCAGG - Intronic
1049429104 8:142550965-142550987 CAGGGCAGGGAAGAGGAGGGAGG + Intergenic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1050042532 9:1511143-1511165 TAGGAAAGGGAACTGGAGGCTGG - Intergenic
1051937782 9:22465511-22465533 CAGGAGAGGGAACTGGTGGCGGG + Intergenic
1052353901 9:27484750-27484772 CAGGGCAGGGTAGAGGAGGCCGG - Intronic
1053283622 9:36837034-36837056 AAGAACAGGGACCCAGAGGCTGG - Exonic
1055722749 9:79193977-79193999 GAGACCAGGGCAGAGGAGGCTGG - Intergenic
1056134733 9:83621103-83621125 CAGAGCAGGGAAGAGAAGGGTGG - Intergenic
1056190785 9:84182016-84182038 AAGAGCAGTGAACATGAGGCTGG + Intergenic
1056732060 9:89174840-89174862 CAGTGCAGGGGACAGGAGGCAGG - Intronic
1056755151 9:89377003-89377025 CAGGACAGGGAAGAGGAGCCAGG + Exonic
1057599841 9:96448799-96448821 AAGACCAGGGAACAGAAGGGGGG + Intergenic
1057793557 9:98140085-98140107 CAGAACAGGGACCAGGACCCAGG + Intronic
1059356335 9:113702212-113702234 CACACCAGGGCACAGAAGGCAGG - Intergenic
1059449376 9:114360730-114360752 CAGCACAGGCAACAGGAGTTGGG + Intronic
1060197870 9:121634928-121634950 CAGAACAGCCAACACCAGGCAGG + Intronic
1060458980 9:123830566-123830588 CAAAACAGGGAAAAGAGGGCCGG + Intronic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1061360456 9:130138550-130138572 CAGAGAAGGGAAGAGGAGGGAGG - Exonic
1061804736 9:133131596-133131618 AAGAACAGGGAATGGGTGGCTGG - Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1061897216 9:133654765-133654787 CCACACAGCGAACAGGAGGCAGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062215809 9:135389234-135389256 CCAATCAGGGACCAGGAGGCAGG + Intergenic
1062349256 9:136131182-136131204 CCAAACAGGGATCAGGAGGGCGG + Intergenic
1062405786 9:136395598-136395620 CAGAACCGGGAGCAGCAGGTGGG - Exonic
1062501928 9:136855399-136855421 CAGAACTGGTGTCAGGAGGCAGG - Intronic
1062586333 9:137251560-137251582 CAGTAGAGGGGACAGGCGGCTGG + Intronic
1185550471 X:979915-979937 AAGAAGAGGGAAGAGGCGGCCGG + Intergenic
1186065762 X:5762607-5762629 CAAAACAGGAAAGAGGAGCCGGG + Intergenic
1186627415 X:11309339-11309361 CAGAGAAGGAGACAGGAGGCAGG + Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187637628 X:21249320-21249342 CAGGACAGGGATGAGGAGGGAGG + Intergenic
1187926100 X:24251740-24251762 CAGCACAGGGTAGAGGAGGATGG - Intergenic
1188438137 X:30185886-30185908 CTGAACAGGGACCTGGATGCAGG + Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189328054 X:40125067-40125089 CAGAACAGGACAAAGCAGGCTGG - Intronic
1189893673 X:45632188-45632210 GAGCACAGGGAACGGGAGGGAGG - Intergenic
1191041650 X:56087540-56087562 CAGAACAGGAACCATGATGCTGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192316560 X:70056289-70056311 CAGAATGGGGAACAGGAGTTGGG + Intergenic
1192324008 X:70117032-70117054 CAGTACAGGAAACATGATGCTGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192765260 X:74133351-74133373 CAGAACAGGCTATTGGAGGCTGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1196778157 X:119359951-119359973 CAGAAAGGGGAACATGAGGAGGG - Intergenic
1197090783 X:122534054-122534076 CAGAACAGAGAACAGTATGGAGG + Intergenic
1197875169 X:131095269-131095291 CAAAGAATGGAACAGGAGGCAGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1200102112 X:153693381-153693403 CAGGACAGGGCACGGGTGGCAGG - Intronic
1202244897 Y:22810222-22810244 CATAACAGGGAACAGCAACCAGG + Intergenic
1202267825 Y:23039479-23039501 CATAACAGGGAACAGTAACCAGG + Intergenic
1202397886 Y:24443968-24443990 CATAACAGGGAACAGCAACCAGG + Intergenic
1202420817 Y:24673223-24673245 CATAACAGGGAACAGTAACCAGG + Intergenic
1202449969 Y:24996859-24996881 CATAACAGGGAACAGTAACCAGG - Intergenic
1202472895 Y:25226119-25226141 CATAACAGGGAACAGCAACCAGG - Intergenic