ID: 906686991

View in Genome Browser
Species Human (GRCh38)
Location 1:47769281-47769303
Sequence TGGGCTGGCTTCAGGACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906686981_906686991 11 Left 906686981 1:47769247-47769269 CCCATCCTTTCAGCCTGAGGAAC 0: 1
1: 0
2: 5
3: 33
4: 370
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303
906686977_906686991 26 Left 906686977 1:47769232-47769254 CCTCCTAGCTGCTGCCCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 422
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303
906686982_906686991 10 Left 906686982 1:47769248-47769270 CCATCCTTTCAGCCTGAGGAACT 0: 1
1: 0
2: 3
3: 25
4: 335
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303
906686978_906686991 23 Left 906686978 1:47769235-47769257 CCTAGCTGCTGCCCCATCCTTTC 0: 1
1: 0
2: 2
3: 41
4: 392
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303
906686986_906686991 -2 Left 906686986 1:47769260-47769282 CCTGAGGAACTGTTGGTTTGGTG 0: 1
1: 0
2: 1
3: 9
4: 127
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303
906686983_906686991 6 Left 906686983 1:47769252-47769274 CCTTTCAGCCTGAGGAACTGTTG 0: 1
1: 0
2: 0
3: 13
4: 213
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303
906686980_906686991 12 Left 906686980 1:47769246-47769268 CCCCATCCTTTCAGCCTGAGGAA 0: 1
1: 0
2: 3
3: 27
4: 304
Right 906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG 0: 1
1: 0
2: 1
3: 23
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906686991 Original CRISPR TGGGCTGGCTTCAGGACAGC AGG Intronic
900239912 1:1611307-1611329 TGGCCGGGCTTCAAGACTGCAGG + Intergenic
901063171 1:6483064-6483086 GAGGCTGGCCTCAGGTCAGCCGG + Intronic
902711132 1:18240725-18240747 TGGGCTGTCTTAAGGACTGGTGG + Intronic
902807311 1:18869167-18869189 TGTGCTGGCTGCAGGCCACCAGG - Intronic
903666864 1:25013426-25013448 CAGGCTGGTGTCAGGACAGCAGG - Intergenic
904419879 1:30384739-30384761 TGGGCTGACCTCAGGGCAGGGGG + Intergenic
905350299 1:37341157-37341179 GGGGTGGGCTTCAGGTCAGCAGG - Intergenic
905385395 1:37599945-37599967 AGGGCTGCCTTCTGGTCAGCAGG - Intergenic
905799797 1:40835867-40835889 AGTGTTGGCTTCAGCACAGCAGG + Intronic
905825797 1:41025133-41025155 TGGCCTGGCTGCAGGGCAGCGGG - Intergenic
905903230 1:41596093-41596115 TGGGATGGCTTCTGGACACTGGG + Intronic
906686991 1:47769281-47769303 TGGGCTGGCTTCAGGACAGCAGG + Intronic
912191111 1:107341816-107341838 TCTTCTGGCTTCAGGAAAGCTGG + Intronic
913335802 1:117708263-117708285 TGGGCTGGGGCCAGGACACCCGG + Intergenic
915294712 1:154911895-154911917 CTGGCTGTCCTCAGGACAGCTGG - Intergenic
918449142 1:184642089-184642111 TGGCCTGGTTTGAGGTCAGCAGG - Intergenic
919912968 1:202123180-202123202 TTGGTTGGCTGCAGGCCAGCAGG - Exonic
920556733 1:206909663-206909685 TGCGCTGGCTCCGGGAAAGCCGG - Intronic
921202190 1:212817971-212817993 TGGGCTGCACTCAGGACATCTGG - Intergenic
921377923 1:214493128-214493150 TGGGCTGGCTGCAGGGCAGAGGG + Intronic
921701152 1:218270570-218270592 TGTGCTTACTTCAGGACATCTGG + Intergenic
922769984 1:228176509-228176531 TGGCATGGCTGCAGGCCAGCAGG + Exonic
924852196 1:247841623-247841645 TGGCTTGGCCCCAGGACAGCAGG + Exonic
1063088356 10:2839563-2839585 AGGGCTGGGATCAGGACAACAGG + Intergenic
1064122163 10:12629227-12629249 TGGGCTTTCTTCAGGACAGGAGG + Intronic
1064141961 10:12798141-12798163 TGGCGTGGCTTCAGGCCAGATGG + Intronic
1064904842 10:20334562-20334584 TGGGCCGGCTGCAGGGGAGCAGG + Intergenic
1065409812 10:25412337-25412359 TGGGCTGTCATCAGCACAGAAGG - Exonic
1065498692 10:26356366-26356388 TGGACTGTCCACAGGACAGCTGG - Intergenic
1066482059 10:35806208-35806230 TGGGCCTGCTTCAGGAGACCGGG + Intergenic
1067190698 10:44065563-44065585 TGGGCAGTCTTCAGGCCTGCTGG + Intergenic
1067550887 10:47235221-47235243 TGGGCTTCCTTCAAGAAAGCTGG - Intergenic
1068116097 10:52739487-52739509 TGCCCTGGCCTGAGGACAGCAGG + Intergenic
1069747839 10:70727073-70727095 TGGGCAGACTTCAGAGCAGCCGG - Intronic
1069872075 10:71539298-71539320 TGGGCTGGGTCCAGGAGGGCTGG - Intronic
1071472259 10:85992003-85992025 TGGGATGGATTCAGGGCAGGGGG + Intronic
1071472433 10:85993183-85993205 TTTGCTGGCCTCAGAACAGCAGG + Intronic
1072030289 10:91513849-91513871 TGGGTTGGCTTCAGAACTGTTGG - Exonic
1073057211 10:100710360-100710382 TGGGCTGGCAGCAGGAGCGCGGG - Intergenic
1073332918 10:102682483-102682505 TGTGCTGCCTTCAGGACACCAGG + Intronic
1074118261 10:110473978-110474000 GGAGGAGGCTTCAGGACAGCTGG - Intergenic
1074923967 10:118047429-118047451 TGGGCTGGCATCAGAAGACCTGG + Intergenic
1075423400 10:122323256-122323278 TGGGCTGGTTTCAGTCCTGCTGG + Intronic
1075732542 10:124645000-124645022 TGGCCTGGCTTCAGCCCTGCAGG - Intronic
1076383432 10:130040212-130040234 TGGGGTGCCTTCAGCCCAGCAGG - Intergenic
1076742444 10:132493403-132493425 TGGGCTGGTTTCGGGAAGGCTGG + Intergenic
1077198024 11:1291314-1291336 CGGGTTGGCTGCAGGAGAGCGGG - Intronic
1079003345 11:16775567-16775589 TGGGCTGCCTTCAGGTCAGCTGG - Intergenic
1079995445 11:27290756-27290778 TGGCATGGCTTCAGGGGAGCTGG - Intergenic
1080613543 11:33926140-33926162 TGGGCTGGCTTGGGCTCAGCTGG - Intergenic
1080802184 11:35618918-35618940 TGGGCTCGCTCCGGGACTGCCGG - Exonic
1080871793 11:36243007-36243029 TATGATGGCTTCAGGACATCAGG + Intergenic
1081058389 11:38439972-38439994 TGTGCTGACTGCAGGAAAGCTGG + Intergenic
1081604286 11:44517736-44517758 TGGGCTGGGGTCGGGACACCTGG + Intergenic
1081810258 11:45910388-45910410 TGGGCTGGCTCCTGGGCCGCAGG - Intronic
1081814855 11:45933261-45933283 TGGGCAGGCTTCAGGAGTGGTGG + Intronic
1081867980 11:46370045-46370067 TGGCCTGGGCTCAGGACCGCAGG - Intronic
1083298042 11:61725803-61725825 TGGCCTGGCTGCTGGCCAGCAGG - Intronic
1083812544 11:65113611-65113633 TGAGCTGGCCTCAGGCCAGGGGG + Intronic
1084065007 11:66699025-66699047 TGGGCCGTCTTCGGGACAACCGG - Exonic
1084276508 11:68054084-68054106 TGGGCAGGGTTCAGGCCAGCAGG - Intronic
1084362947 11:68680838-68680860 TGGGCTGGCTCGAAGGCAGCGGG + Intergenic
1084364037 11:68686057-68686079 TGGGCTGCCTTCAGGCGATCTGG - Intronic
1085016113 11:73175040-73175062 TGGGCGGGGGTCAGGACACCTGG - Intergenic
1088710501 11:112504015-112504037 GGGGTTAGCTTCAGGACAGGTGG + Intergenic
1091182940 11:133623381-133623403 TGGCCTGGCTAAAAGACAGCAGG + Intergenic
1095971064 12:47902347-47902369 CAGGCTGGCTTCAGCCCAGCTGG + Intronic
1096490544 12:52010415-52010437 TGGGCTGGCCCCAGCATAGCTGG + Intronic
1096537823 12:52286669-52286691 TGGGCTGGCATCACAACAGGAGG - Intronic
1096684181 12:53276998-53277020 AGGGCTAGCTGCAGAACAGCTGG - Intronic
1097866063 12:64560041-64560063 AAGGCTGGCTTCAGGAGACCTGG - Intergenic
1098262693 12:68686980-68687002 AGGGCTTGCTTCCGGAGAGCGGG + Exonic
1100430564 12:94528585-94528607 TGGCCTTGCTTCAGGAGAGAGGG + Intergenic
1101349288 12:103913507-103913529 TGAGCTAACATCAGGACAGCAGG + Intergenic
1105292331 13:19060951-19060973 TGTGCTGTCTTTATGACAGCAGG - Intergenic
1106769007 13:32943912-32943934 TGGGCTGCTCTCAGGAGAGCTGG - Intergenic
1106892953 13:34266392-34266414 TGGGCTGGGTTCAGAATAGGTGG - Intergenic
1107446041 13:40471249-40471271 TGGAATGGCTTCAGGCCACCTGG - Intergenic
1112475880 13:99730495-99730517 TGGCCTGTCTTGAGGAAAGCTGG - Intronic
1113663759 13:112126333-112126355 GGGGCTAGCTTCAGGAAAGAAGG + Intergenic
1113784540 13:112995595-112995617 GGGGGTGACTTCAGGCCAGCAGG - Intronic
1115150003 14:30273493-30273515 TAGGCTGCCTTACGGACAGCTGG - Intergenic
1118163826 14:63316736-63316758 TGTGCTGTCTCCAGGAAAGCAGG + Intronic
1118805926 14:69236909-69236931 AGAGCAGGCTTCAGGACATCTGG - Intronic
1121211988 14:92214086-92214108 CGGGCTGGCCCCAGGTCAGCTGG - Intergenic
1121595288 14:95157465-95157487 TGCGCTGGCTGCCGGCCAGCCGG - Intronic
1121624099 14:95371976-95371998 TGGGCTGACCTGTGGACAGCAGG - Intergenic
1122198794 14:100109330-100109352 TGGGAAGGCTTCACAACAGCAGG - Intronic
1122825178 14:104367310-104367332 GGGGCTGTCTGCAGGGCAGCAGG - Intergenic
1123063067 14:105603032-105603054 TGGGCTGGGTTCAGCTGAGCGGG - Intergenic
1123109261 14:105857947-105857969 TGGGCTGGGTTGAGCAGAGCTGG - Intergenic
1124139127 15:27062056-27062078 TGGGCTGCCTTCCGGGCAACTGG + Intronic
1126288440 15:47043610-47043632 TGGCTTTGCATCAGGACAGCAGG + Intergenic
1128185477 15:65640476-65640498 TGGGGAGGCTCCAGGAGAGCAGG - Intronic
1128502230 15:68234568-68234590 TGGGCTGTCATGGGGACAGCAGG - Intronic
1129032696 15:72630031-72630053 TGGGGTGCCTTGTGGACAGCAGG + Intergenic
1129033677 15:72637147-72637169 TGTGCGGGCGTCAGGGCAGCAGG + Intergenic
1129216204 15:74100069-74100091 TGTGCGGGCGTCAGGGCAGCAGG - Intergenic
1129385868 15:75195889-75195911 TGGGCTGGAGTCAGGGCTGCGGG + Intronic
1129706019 15:77795069-77795091 TGGGGTGGGCTCAGGGCAGCAGG - Intronic
1131269945 15:90941102-90941124 TGAGTTGGCTGCAGGAAAGCTGG - Intronic
1131444457 15:92485700-92485722 TAAGCTGGCTTCAGGAAAGGAGG + Intronic
1132456828 16:28768-28790 AGGGGCAGCTTCAGGACAGCAGG - Intergenic
1132595322 16:746481-746503 TGGGCGGGCTGCAGGAGAGGAGG + Intronic
1132595334 16:746525-746547 TGGGCGGGCTGCAGGAGAGGAGG + Intronic
1132806618 16:1777962-1777984 TGGGCAGGGATGAGGACAGCTGG - Exonic
1134062221 16:11206093-11206115 TGGGCTGCCTCCTGGACAGCTGG - Intergenic
1136748850 16:32615278-32615300 TGGGCTGGGGTCAGAAGAGCTGG + Intergenic
1137770233 16:51010527-51010549 GGGTCTGGCTTCAAGACAACTGG - Intergenic
1138066572 16:53947436-53947458 TGGGCTTGGTTCAGGAGAGGAGG + Intronic
1138681074 16:58684116-58684138 TGTGCTGGCTTCAGCAGAGCTGG + Exonic
1141603076 16:85137771-85137793 TGGGGTGGCTTAGGGACAGGGGG + Intergenic
1141651160 16:85393907-85393929 TGGGCCTGCATCAGGACTGCCGG - Intergenic
1141751614 16:85962089-85962111 TGGGCAGGCTTCATGGCTGCCGG + Intergenic
1141825638 16:86477859-86477881 TCGCCTGGCTTCAGGACAATGGG - Intergenic
1203050983 16_KI270728v1_random:874492-874514 TGGGCTGGGGTCAGAAGAGCTGG + Intergenic
1143204513 17:5132725-5132747 TGGGCTGGCTTTGGGACCCCGGG - Intronic
1143258424 17:5581543-5581565 TGGCCTGGGGTCAGGAGAGCTGG - Intronic
1143784209 17:9244770-9244792 AGGGCTGCCTTCAAAACAGCTGG - Intergenic
1144777049 17:17790056-17790078 TGGGCAGGCCTCAGGAGAGGAGG - Intronic
1144875584 17:18395411-18395433 TGGGCTGGCTTTGGGACCCCAGG - Intergenic
1145156642 17:20549010-20549032 TGGGCTGGCTTTGGGACCCCAGG + Intergenic
1145784597 17:27585842-27585864 CTGGCTGGCTTCAGCCCAGCTGG + Intronic
1146397525 17:32480635-32480657 AGTGCTGGCTTCAGGACCCCAGG + Intronic
1146844146 17:36173088-36173110 TGGGCTGGCTTTGGGACCCCGGG + Intronic
1146856451 17:36261023-36261045 TGGGCTGGCTTTGGGACCCCGGG + Intronic
1146864166 17:36327352-36327374 TGGGCTGGCTTTGGGACCCCGGG - Intronic
1146872361 17:36384934-36384956 TGGGCTGGCTTTGGGACCCCGGG + Intronic
1146879719 17:36436019-36436041 TGGGCTGGCTTTGGGACCCCGGG + Intronic
1147067026 17:37927940-37927962 TGGGCTGGCTTTGGGACCCCGGG - Intronic
1147075245 17:37985558-37985580 TGGGCTGGCTTTGGGACCCCGGG + Intronic
1147078558 17:38007501-38007523 TGGGCTGGCTTTGGGACCCCGGG - Intronic
1147086770 17:38065104-38065126 TGGGCTGGCTTTGGGACCCCGGG + Intronic
1147094496 17:38131436-38131458 TGGGCTGGCTTTGGGACCCCGGG - Intergenic
1147102715 17:38189067-38189089 TGGGCTGGCTTTGGGACCCCGGG + Intergenic
1147621474 17:41870876-41870898 TGTGCTGGCCTCACGTCAGCAGG - Intronic
1147933290 17:43996189-43996211 TGGGCTGCTTACAGGGCAGCTGG - Intronic
1148166837 17:45489967-45489989 TGGGCTGTCCTCAGTACGGCAGG + Intronic
1148367650 17:47068814-47068836 TGGGGTGTCCTCAGGACGGCAGG - Intergenic
1149847288 17:60015534-60015556 TGGGCTGGCTTTGGGACCCCGGG + Intergenic
1150085646 17:62272151-62272173 TGGGCTGGCTTTGGGACCCCGGG + Intergenic
1150133138 17:62680015-62680037 GGAGCCGGCTTCAGGAAAGCAGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150447166 17:65235517-65235539 TTGGCTGGCTTCTTTACAGCAGG - Intergenic
1151055855 17:71030899-71030921 TGGGCTGGCTTGAGGAAGGAAGG - Intergenic
1151289422 17:73138836-73138858 TGGGCTGGTATCTGGCCAGCAGG - Intergenic
1151887359 17:76930997-76931019 TGGGCTGGCTTTATGAATGCTGG - Intronic
1152325669 17:79634395-79634417 TAGCCTGTCTTGAGGACAGCAGG - Intergenic
1152337661 17:79707456-79707478 GGCGCTGGCCTCAGGACACCAGG + Intergenic
1152574641 17:81134676-81134698 GTGGCTGGCTGCAGGACTGCAGG - Intronic
1152622860 17:81373917-81373939 CGGGCTGGCTTCAGCAGAGGAGG - Intergenic
1153627047 18:7031282-7031304 TGGCCTGGCTTCAGGGCATAGGG + Intronic
1153913735 18:9726874-9726896 AGGGTGGGCTTCTGGACAGCTGG - Intronic
1157584480 18:48792319-48792341 TGGGAAGGCATCAGGTCAGCGGG + Intronic
1158427484 18:57352817-57352839 TGGGCTGGGTTCAGGGAAACCGG - Exonic
1158529188 18:58242829-58242851 GGAGCTGGCTACAGGACAGTAGG - Intronic
1159560008 18:69983883-69983905 TCTGCTGGCTTCAAGACTGCTGG - Intergenic
1160939861 19:1615185-1615207 AGGGCTGGCTCCAGGAAGGCGGG + Intronic
1161685085 19:5698596-5698618 TGGGCTGGAGTCAGGAGAGACGG - Intronic
1161775901 19:6262026-6262048 ACGGCTGGTTTCATGACAGCAGG - Intronic
1162457404 19:10793903-10793925 AGGCCTGGCTTGAGGCCAGCAGG - Intronic
1162969289 19:14170428-14170450 TGGGCTGGGGTAAGGAGAGCTGG + Intronic
1163607782 19:18284827-18284849 AGGGCTGGCTACAGGTCTGCGGG - Intergenic
1165154252 19:33777675-33777697 TGGGCCGGCCTCAGGAAAGGAGG + Intergenic
1166538737 19:43592274-43592296 GGGCCTGGCTTCTGGAGAGCTGG - Exonic
1168111161 19:54191933-54191955 TGGCCAGGCTTCGGGAGAGCAGG + Exonic
1168589261 19:57619065-57619087 TGGCAAGGCTTCAGGGCAGCAGG - Intronic
927095991 2:19747970-19747992 TGGGCTGGCCTTTGGAGAGCAGG - Intergenic
927869796 2:26616242-26616264 TCGGCTGACCTCAGGCCAGCTGG - Intronic
928177876 2:29047197-29047219 AGGGCTGGCTGCAGGTGAGCTGG + Intronic
929920190 2:46166222-46166244 TGGGCTGGCTTCAGGGGAAGGGG - Intronic
930715548 2:54590841-54590863 TGGACTGTCTTCTGGATAGCTGG + Intronic
932445176 2:71776382-71776404 TGGGCAGGCTCCAGGGCTGCTGG + Intergenic
934475142 2:94588579-94588601 TGGGCTGGGTGGAGGACAGGGGG - Intronic
934656965 2:96121432-96121454 TGGGCTGGAAGCAGAACAGCCGG - Intergenic
934852118 2:97707966-97707988 TGGGGTGGCTGTAGGGCAGCAGG + Intergenic
936152057 2:110027429-110027451 TGGGCTGCCCTCTGGACAGTAGG + Intergenic
936192621 2:110343984-110344006 TGGGCTGCCCTCTGGACAGTAGG - Intergenic
936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG + Intergenic
937232168 2:120404585-120404607 TGGGAAGCCTTCAGGTCAGCTGG + Intergenic
937435143 2:121873964-121873986 GGTGCTGGCTTCATGGCAGCAGG + Intergenic
937593714 2:123647255-123647277 TGAGCTGGCTCCAGGAGAGTGGG - Intergenic
938796235 2:134719619-134719641 TGGGGTATCTTTAGGACAGCGGG + Intergenic
940739494 2:157490861-157490883 GGGGCAGGCTTCAAGACAGAGGG - Intergenic
941929744 2:170928226-170928248 GGGCCTTCCTTCAGGACAGCTGG - Intergenic
947532908 2:230924088-230924110 TGGGGTTGCTGGAGGACAGCAGG - Intronic
947671530 2:231939596-231939618 TGGGCTGGCTCCAGAACCGAGGG + Intergenic
948248138 2:236503714-236503736 TGGAGAGGCATCAGGACAGCTGG - Intronic
948378318 2:237536794-237536816 CGGGCAGGCTACAGGACAGCGGG - Intronic
948591911 2:239055875-239055897 AAGGCTGGCTCCAGGACACCTGG - Intronic
949003888 2:241634393-241634415 CAGGATGGCCTCAGGACAGCAGG + Intronic
1168829604 20:838384-838406 TGGGCTGGGTCCAGAACAGCCGG + Intronic
1169263641 20:4154871-4154893 TGGGCTGGGGGCAGGACAGAGGG + Intronic
1169578299 20:6990779-6990801 TGCGATGGCTTCTGGACAGAAGG + Intergenic
1170480298 20:16758637-16758659 TTGGCTGGGTGTAGGACAGCAGG - Intronic
1170804719 20:19619443-19619465 TGGGGTGGCTTGAGGATTGCAGG - Intronic
1171989355 20:31684087-31684109 TGGACTGGCTTCCGGTCAGCTGG - Intronic
1172526092 20:35601302-35601324 TGGGCTGGTTACTGGACAGGCGG + Intergenic
1173202010 20:40961287-40961309 GGGGCTGGAGTTAGGACAGCTGG - Intergenic
1173552971 20:43946237-43946259 TGGGCTGTCCTCTGGAGAGCAGG + Intronic
1174337335 20:49872325-49872347 TGGGCTGGCTGAGTGACAGCAGG - Intronic
1174388378 20:50200691-50200713 TGGGCTGGCCCCAGGAAGGCTGG - Intergenic
1175933426 20:62504095-62504117 TGGGCTGGCTGCGGGGCAGGTGG - Intergenic
1176208501 20:63904676-63904698 TGGACTGACTCCAGAACAGCTGG + Intronic
1180160899 21:45998257-45998279 CGGGCTGGCCCCAGGACCGCCGG + Intronic
1180982948 22:19887777-19887799 TGGCCTGCCTTCAGGATGGCTGG - Intronic
1181101874 22:20546179-20546201 GGGGAGGGCTGCAGGACAGCTGG - Intronic
1181236183 22:21448870-21448892 CGGGGTGGCGTCAGGACGGCAGG - Exonic
1181312188 22:21951322-21951344 TCGGTTGGCTTCAGGTCAGATGG + Intronic
1181455216 22:23055621-23055643 TGGGCTTGCCTGAAGACAGCAGG - Intergenic
1182071469 22:27466711-27466733 TTGGCTGGCTTCAAAAGAGCAGG + Intergenic
1183583793 22:38740516-38740538 TGGGCTCCCGTCAGGAGAGCGGG + Intronic
1183587802 22:38762943-38762965 TGGGCTGGCATCTGGGAAGCTGG + Intronic
1184248751 22:43248686-43248708 TGGCCTGGCTGAAGGAAAGCGGG - Intronic
1184838905 22:47040933-47040955 TCGGCTGCCTTCAGGGCTGCGGG + Intronic
1185192791 22:49449591-49449613 GGGGCTGCCCTCAGGAGAGCGGG + Intronic
950595342 3:13975712-13975734 TGGTCAGGCTTCAGGCCAGTAGG + Intronic
952412605 3:33063066-33063088 TGGGATGGCTTCCAGACAGAAGG + Intronic
952924434 3:38310780-38310802 TGGGGTGCCTTTAAGACAGCAGG + Intronic
952956437 3:38560633-38560655 TGGTGTGGCTTCAGAACATCTGG + Intronic
953666253 3:44928466-44928488 TGAGGTGGCCTCAGGACACCAGG + Intronic
961447518 3:126987815-126987837 TTGCCTGGCTTCTGGACTGCAGG + Intergenic
961509061 3:127390177-127390199 TGGGCTGTTTTCAGAACACCTGG - Intergenic
961821168 3:129576366-129576388 TGGGAAGGCTTCAGAACAGGGGG - Intronic
962220390 3:133560025-133560047 TGGGCTGACTCCTGGACAGCAGG + Intergenic
962705231 3:138037082-138037104 TGGGCTTGCTTCAGGATGGGTGG + Intergenic
963173359 3:142273684-142273706 TGTGCTGACTTCATGACAGCTGG + Intergenic
964414091 3:156429382-156429404 AGGGCTGGCCTCAGGGCAGGTGG + Intronic
966946548 3:184781006-184781028 AGGGCCAGCTTCAGGACTGCAGG - Intergenic
967923853 3:194631752-194631774 TGGGCTGGGTTAAGGTCAGCTGG - Intronic
968504704 4:966469-966491 TGGACCGGCTACAGGACATCCGG - Exonic
968592270 4:1465108-1465130 TGGCCTGGCCTCAGGCCTGCAGG - Intergenic
969298369 4:6282639-6282661 TGGGCTGGGAGCAGGGCAGCTGG - Intronic
969346918 4:6575658-6575680 GGGGCTGGCTTCAGAGCAGGTGG + Intronic
969523448 4:7692177-7692199 TGGGCTGGCTTCACATCTGCTGG + Intronic
971268080 4:25112137-25112159 TGCCCTGGCTTCATGTCAGCAGG + Intergenic
972482050 4:39506136-39506158 TGGGATGGCTTGAGCACAGGAGG + Intronic
982035798 4:151344473-151344495 TGGCCTGGGTGCAGGACATCTGG + Intergenic
983640721 4:169941927-169941949 TGGGCTGGCTCCAGGCCACATGG - Intergenic
986130967 5:4929540-4929562 AGGGATGACTTCAGAACAGCAGG + Intergenic
987127764 5:14830873-14830895 TCGCCTGGCTTCAGGACTGAGGG + Intronic
991976029 5:72184304-72184326 TGGGCTGGCACCAGGTCACCTGG + Intronic
994926913 5:106127452-106127474 TTGGCTGGCCTCAGGTGAGCTGG + Intergenic
996909443 5:128638411-128638433 TGTGCAGGCTTCAGACCAGCTGG - Intronic
997613869 5:135233078-135233100 TGGGCAGGCGGCAGGCCAGCCGG - Intronic
1000305141 5:159987705-159987727 TGCGCTGGCTTCAGGGAATCTGG + Intergenic
1001990735 5:176113655-176113677 TGGGCTGGGGTCAGAAGAGCTGG + Intronic
1002100878 5:176856962-176856984 TGGGCTTGTTTGAGGACAGCAGG - Intronic
1002226138 5:177724485-177724507 TGGGCTGGGGTCAGAAGAGCTGG - Intronic
1002267711 5:178046728-178046750 TGGGCTGGGGTCAGAAGAGCTGG + Intronic
1002283900 5:178149649-178149671 TGGGCTGGCAGCAGGACGACTGG - Exonic
1004505789 6:16245794-16245816 TGGGCTTGCTTAGGGAAAGCTGG + Intronic
1006411438 6:33876220-33876242 TGGGCTGCCCTTAGGTCAGCTGG - Intergenic
1007566956 6:42858881-42858903 TGGCCAGGCATCAGGACAGAAGG - Intronic
1012827377 6:104163098-104163120 TGGGCTCCCTTCAGGGCAGTGGG - Intergenic
1013351906 6:109313399-109313421 ACCGCTGGCTGCAGGACAGCAGG + Intergenic
1016567400 6:145471915-145471937 TGGGGTGGCTCCAGGAGTGCTGG + Intergenic
1016660278 6:146570118-146570140 TGGCCTGGGCTCTGGACAGCTGG - Intergenic
1016806374 6:148216520-148216542 TGGGCTGGAGTCAGGACATGTGG + Intergenic
1017137562 6:151161671-151161693 TGGGCTGTCTTCAGAGCAGATGG + Intergenic
1017523746 6:155224824-155224846 TGGCCTGGCATCTGCACAGCGGG + Intronic
1018931173 6:168241343-168241365 TGGGCAGGGATCAGGTCAGCGGG + Intergenic
1019161131 6:170067453-170067475 TGGGATGGCTTCATGAATGCTGG + Intergenic
1019609838 7:1930823-1930845 TGTGAGGGCTTCAGGCCAGCAGG - Intronic
1019710431 7:2515927-2515949 TTGGCTGGGCTCAGCACAGCCGG - Intronic
1022303641 7:29125956-29125978 TGCGCTGGCTTGAGCACATCAGG - Intronic
1023493613 7:40770359-40770381 TGGGATGTCTTCAGGAAATCAGG + Intronic
1023683886 7:42715738-42715760 GGAGCTGGTTTCAGGACTGCAGG - Intergenic
1024221719 7:47293998-47294020 TAGCCGGGCTGCAGGACAGCTGG + Intronic
1024548606 7:50542061-50542083 TGTGATGCCTTCAGCACAGCAGG + Intronic
1025094806 7:56088692-56088714 TGTCCTGGCTTCAGGAGGGCAGG + Intronic
1025187916 7:56875402-56875424 TGTCCTGGCTTCAGGAGGGCAGG + Intergenic
1025684006 7:63701522-63701544 TGTCCTGGCTTCAGGAGGGCAGG - Intergenic
1027761874 7:82288934-82288956 TGGGCTGCGTTCATTACAGCAGG - Intronic
1029340400 7:99939185-99939207 TGGGGTGGCTTTTGGAAAGCTGG - Intergenic
1032482303 7:132256761-132256783 TGGGCTGGGTTTGGGACAACTGG + Intronic
1032708423 7:134442052-134442074 TGGGCTGTGATCAGGACAGCAGG - Intergenic
1033239277 7:139663850-139663872 TGGGTGGGCTTCGGGAAAGCAGG - Intronic
1035179936 7:157081956-157081978 TGGGCTGGCTCCAAGAGAGCAGG + Intergenic
1035604420 8:920265-920287 TGGGCTCCCAGCAGGACAGCAGG + Intergenic
1036545847 8:9768890-9768912 TGTGCTGGATCCAGGACAACTGG - Intronic
1038243827 8:25835168-25835190 TGGACTGGCTATAGCACAGCAGG + Intergenic
1038275053 8:26114452-26114474 TGTGCTGGCTTCAGGACTGGTGG - Intergenic
1039454864 8:37699600-37699622 GGGGCCGGCTTCACGCCAGCGGG - Exonic
1039906608 8:41791009-41791031 TGGGCTGACAGCAGGACAGAGGG + Intronic
1040326349 8:46343543-46343565 TGGGCTGGCATCAGGTAATCAGG + Intergenic
1040737446 8:50526122-50526144 TGGTCTGGCTGCAGAACTGCAGG + Intronic
1040901644 8:52423293-52423315 GGGGCTGGCTTCTGGGCAGCAGG - Intronic
1041545579 8:59038880-59038902 GGGGCAGGCTGCAGGAGAGCAGG - Intronic
1042906167 8:73774224-73774246 GGGACTGGCTTCAGAACAGCTGG - Intronic
1043760475 8:84062401-84062423 TGTGCTGGCTTCAGGTCTGATGG - Intergenic
1044077980 8:87846820-87846842 TGGTCTGCCTCCAGGCCAGCTGG + Intergenic
1046462027 8:114551961-114551983 TGGACTGCCTTCAACACAGCAGG + Intergenic
1047338477 8:123957860-123957882 AGGGCTGGCCTGTGGACAGCAGG - Intronic
1047775491 8:128067072-128067094 TGGTCTGGGTTCAGGAGAGCAGG - Intergenic
1047821052 8:128521183-128521205 TGGTCTGCTTTCAGAACAGCAGG + Intergenic
1048318147 8:133377102-133377124 TGGGGTGAGTTCAGGACAGGCGG + Intergenic
1048403975 8:134099652-134099674 TGAGCTGGCTGCTGGTCAGCTGG - Intergenic
1049232012 8:141489338-141489360 AGGGCTGCCTTGAGGGCAGCTGG - Intergenic
1049399026 8:142416589-142416611 AGGGCTGGGCCCAGGACAGCTGG + Intergenic
1049420772 8:142515581-142515603 TGGGCTGGCCTGAGGCCGGCTGG - Intronic
1052507940 9:29379097-29379119 GGGACTGCCTTCAGGACAGGAGG + Intergenic
1052854908 9:33401183-33401205 TGGGCTGGGTGAAGGACAGGGGG + Intronic
1053682930 9:40497512-40497534 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1053932911 9:43125826-43125848 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054280784 9:63127416-63127438 TGGGCTGGGTGGAGGACAGGGGG - Intergenic
1054296030 9:63333012-63333034 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054394046 9:64637507-64637529 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054428695 9:65142719-65142741 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054501684 9:65878823-65878845 TGGGCTGGGTGGAGGACAGGGGG - Intronic
1055073934 9:72194593-72194615 TGGGGTGGCTGCAGGAGTGCTGG - Intronic
1056958052 9:91098427-91098449 TGGGTCGGCTTCAGGCCTGCAGG - Intergenic
1057134326 9:92676520-92676542 TGGGGTTGCCTCAGGACAGCAGG - Intergenic
1058592170 9:106576601-106576623 GGGGATGGCTCCAGGCCAGCAGG - Intergenic
1059450313 9:114367618-114367640 TGGGGTGGCTTCCGGAGAACCGG - Exonic
1060013886 9:120069463-120069485 TGTGCTGGTTTCAGGACTGTTGG - Intergenic
1061724775 9:132576082-132576104 TGGACAGGCTTAAGGACACCTGG + Intergenic
1062276961 9:135735832-135735854 CGAGCTGGCTTCGGGGCAGCTGG + Intronic
1062474178 9:136719351-136719373 TGGGGTGGCTTCGGGAGAGCTGG - Intronic
1062643852 9:137536360-137536382 TGGGATGGCGTCTGGACAGCAGG + Intronic
1186657678 X:11632892-11632914 TGAGCTGGCTTCAGCACAAAGGG - Intronic
1191219751 X:57975751-57975773 TGGGATGACTCAAGGACAGCTGG + Intergenic
1193526114 X:82591614-82591636 TGAGCTGGCTTTAATACAGCTGG + Intergenic
1197149829 X:123208004-123208026 TGAGCTGGCTTCTGAGCAGCAGG - Intronic
1199694725 X:150335738-150335760 AGGACTGGCTTCAGGCCTGCTGG - Intergenic
1200114790 X:153765279-153765301 TGGCCTGGCCTCTGGACAGAGGG + Intronic
1200392195 X:155955896-155955918 TGCTGTGGCTACAGGACAGCTGG + Intergenic
1200399532 X:156010955-156010977 AGGGGCAGCTTCAGGACAGCAGG + Intergenic