ID: 906688037

View in Genome Browser
Species Human (GRCh38)
Location 1:47775171-47775193
Sequence TGTCCTCGATGCGGACCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 49}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906688030_906688037 -3 Left 906688030 1:47775151-47775173 CCTGCCCTCCCTGGCTCACCTGT 0: 1
1: 0
2: 5
3: 64
4: 656
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688023_906688037 27 Left 906688023 1:47775121-47775143 CCGGGTGCAGACGCCCAGCTCCT 0: 1
1: 0
2: 4
3: 17
4: 246
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688031_906688037 -7 Left 906688031 1:47775155-47775177 CCCTCCCTGGCTCACCTGTCCTC 0: 1
1: 0
2: 4
3: 90
4: 750
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688026_906688037 14 Left 906688026 1:47775134-47775156 CCCAGCTCCTGGGCAGACCTGCC 0: 1
1: 1
2: 5
3: 51
4: 394
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688027_906688037 13 Left 906688027 1:47775135-47775157 CCAGCTCCTGGGCAGACCTGCCC 0: 1
1: 0
2: 14
3: 56
4: 402
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688032_906688037 -8 Left 906688032 1:47775156-47775178 CCTCCCTGGCTCACCTGTCCTCG 0: 1
1: 0
2: 0
3: 36
4: 310
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688028_906688037 7 Left 906688028 1:47775141-47775163 CCTGGGCAGACCTGCCCTCCCTG 0: 1
1: 0
2: 3
3: 70
4: 465
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49
906688022_906688037 28 Left 906688022 1:47775120-47775142 CCCGGGTGCAGACGCCCAGCTCC 0: 1
1: 0
2: 2
3: 25
4: 274
Right 906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906688037 Original CRISPR TGTCCTCGATGCGGACCCAG AGG Exonic