ID: 906689240

View in Genome Browser
Species Human (GRCh38)
Location 1:47781769-47781791
Sequence TGCCCCAGAACTGTGTAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906689237_906689240 -10 Left 906689237 1:47781756-47781778 CCCATGTGGCCTGTGCCCCAGAA 0: 1
1: 0
2: 0
3: 35
4: 305
Right 906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG 0: 1
1: 0
2: 2
3: 14
4: 146
906689230_906689240 30 Left 906689230 1:47781716-47781738 CCAGGTGGCTACTCCTTGCACAA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG 0: 1
1: 0
2: 2
3: 14
4: 146
906689236_906689240 -5 Left 906689236 1:47781751-47781773 CCATTCCCATGTGGCCTGTGCCC 0: 2
1: 0
2: 3
3: 28
4: 335
Right 906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG 0: 1
1: 0
2: 2
3: 14
4: 146
906689233_906689240 17 Left 906689233 1:47781729-47781751 CCTTGCACAACTCCAGGAGGCGC 0: 2
1: 1
2: 9
3: 27
4: 148
Right 906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG 0: 1
1: 0
2: 2
3: 14
4: 146
906689234_906689240 5 Left 906689234 1:47781741-47781763 CCAGGAGGCGCCATTCCCATGTG 0: 1
1: 0
2: 1
3: 11
4: 101
Right 906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG 0: 1
1: 0
2: 2
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906689240 Original CRISPR TGCCCCAGAACTGTGTAATG CGG Intronic
902983602 1:20142279-20142301 TGCCCCAGGTTTGTGTACTGCGG - Intronic
903858166 1:26349411-26349433 TGCCCCAGAGCTGTGGCCTGGGG - Intronic
904469660 1:30728531-30728553 TGTCTCAGAACTGTTCAATGGGG - Intergenic
906494737 1:46296554-46296576 TGCCCCATAACTAGGTGATGGGG - Intronic
906689240 1:47781769-47781791 TGCCCCAGAACTGTGTAATGCGG + Intronic
910809785 1:91224436-91224458 TCCCCCAAATCTCTGTAATGGGG + Intergenic
911261342 1:95689996-95690018 TGCCCTGGAAATGAGTAATGTGG - Intergenic
912145940 1:106794604-106794626 TGCCCCAGATCTGAGAAATTCGG - Intergenic
915475774 1:156151999-156152021 TGGCTCAGAACTGTGGACTGGGG + Intronic
919929602 1:202212867-202212889 TGCCTCAGAGCTGTGCAAAGGGG - Intronic
922134626 1:222813000-222813022 TGCCCCAGAAATCTTAAATGAGG - Intergenic
923668644 1:236021089-236021111 TGAAGCAGAGCTGTGTAATGAGG + Intronic
924589744 1:245392374-245392396 TGCAGCTGAGCTGTGTAATGTGG + Intronic
1065114884 10:22475936-22475958 TGCCCCAGAACTGTTAACTGCGG - Intergenic
1065787337 10:29229144-29229166 TGCCCCATGACTTTGTAATGAGG + Intergenic
1066975188 10:42361788-42361810 TGCCTCAGTAATGTGTAATGAGG - Intergenic
1070411978 10:76150167-76150189 TGCCACAGAAGTGTGTAGCGCGG - Intronic
1071778615 10:88817495-88817517 TGCCCTGGAATTGTGCAATGTGG - Intronic
1073120535 10:101119922-101119944 TGCCCAAGGACTCAGTAATGAGG - Intronic
1074263757 10:111880599-111880621 TGCCCCACATCTGTAAAATGAGG - Intergenic
1075564077 10:123491089-123491111 AGACCCAGAGCTGTGAAATGAGG - Intergenic
1076482150 10:130791986-130792008 GGCCCCTGAACTGGGTGATGGGG - Intergenic
1077772815 11:5238846-5238868 AGAGCCAGAACTGTCTAATGGGG - Intergenic
1077986237 11:7354169-7354191 TGCCCCAGAGGTGTGCAATGTGG - Intronic
1078709091 11:13773111-13773133 ATGCCCAGAACTGAGTAATGAGG + Intergenic
1080106261 11:28514108-28514130 TGCACCCTAACAGTGTAATGGGG - Intergenic
1085333827 11:75674629-75674651 TCCCCCAGAAGTATATAATGTGG + Intergenic
1085976732 11:81664158-81664180 TGCCCCATGACTGTGACATGAGG + Intergenic
1092097518 12:5855635-5855657 TGCGCCAGAACTGAGTTAGGTGG + Intronic
1095290559 12:40474903-40474925 TTCCTCAGAAGTGTGTGATGTGG + Exonic
1096462453 12:51829466-51829488 TGGCCCAGAACTGGGGAAAGAGG - Intergenic
1096753719 12:53781326-53781348 TGCCCCGGAAATGAGTAGTGGGG - Intergenic
1097201227 12:57280495-57280517 TGCCCCAGAAGTGTGCAACCAGG - Exonic
1098284281 12:68892461-68892483 TGCCCCAGAGCTGTGGAATGTGG + Intronic
1101230817 12:102739211-102739233 TGCTGCAGAAATGTGTAAAGGGG - Intergenic
1102059559 12:109922502-109922524 TGGCCCAGTTCTGTGAAATGTGG + Intronic
1102752978 12:115312093-115312115 TGCACAAGCACTGTGTCATGTGG + Intergenic
1105050081 12:133041379-133041401 TGCCCCAAAACTGTGGAGTGAGG - Exonic
1105242196 13:18618962-18618984 TCTCCCAGAACTGTGTAAACCGG + Intergenic
1105281312 13:18964319-18964341 TGCCTCAAAACTATGTAATGTGG - Intergenic
1105290526 13:19050334-19050356 TGCCTCAAAACTATGTAATGTGG - Intergenic
1105826750 13:24129852-24129874 TGTCCCAGAGCTGTGGCATGGGG - Intronic
1109885176 13:68532564-68532586 TGTCCCAGATCTGTGTGGTGAGG - Intergenic
1116543073 14:46123550-46123572 TGAGGCAGAACAGTGTAATGGGG + Intergenic
1116626874 14:47276707-47276729 TGCCCCAGAAATGTGTTATTTGG + Intronic
1116997459 14:51339030-51339052 TGCCCCAGAACTCAGTCCTGAGG + Intergenic
1117474848 14:56083716-56083738 TTCCTCAGAACTGTCTAATCTGG + Intergenic
1118045813 14:61969960-61969982 TCCCCCAAGACTGTGTACTGGGG - Intergenic
1118721303 14:68596123-68596145 TGCCCCAGAAGTGTCTGTTGTGG - Intronic
1119214179 14:72856042-72856064 GGCCACAGAAATGTTTAATGAGG - Intronic
1120035056 14:79687112-79687134 TGCCCCAAAGGTGTGTAGTGAGG + Intronic
1121576401 14:94991947-94991969 GGTCTCAGAACTGTGTAAAGAGG + Intergenic
1122132705 14:99614350-99614372 GGCCACAGAACTCTGCAATGAGG + Intergenic
1122853752 14:104550026-104550048 TGGCCCAGAACTGTGCTGTGTGG - Intronic
1122858670 14:104572315-104572337 TGCCCCAGAACGGGGCAAGGGGG + Intronic
1123489120 15:20765634-20765656 CGTCCCAGAACTGTGTAAACCGG - Intergenic
1123545619 15:21334721-21334743 CGTCCCAGAACTGTGTAAACCGG - Intergenic
1125684336 15:41554720-41554742 TGACCCAGAACTGTTCAAGGAGG - Intergenic
1125891278 15:43268908-43268930 ACCCCCAGAACTGTGTACTGCGG + Intergenic
1127873702 15:63094313-63094335 TGAACCAGAAATGTGAAATGGGG + Intergenic
1129915607 15:79267232-79267254 TACCCCAGACCTGTGGAATCAGG - Intergenic
1130050854 15:80482439-80482461 TGCTCCTGACCTGTGAAATGGGG - Intronic
1131635583 15:94230350-94230372 TGGCCCAGGACACTGTAATGAGG + Intergenic
1132424915 15:101707803-101707825 TGCCACAGAACTGTATACTTAGG + Intronic
1202953960 15_KI270727v1_random:61991-62013 CGTCCCAGAACTGTGTAAACCGG - Intergenic
1135530722 16:23251070-23251092 TTCACCAGAACTGTGTCATATGG - Intergenic
1138740987 16:59310006-59310028 TGTCCCAGACCAGTGTTATGTGG - Intergenic
1139228057 16:65252376-65252398 TCATCCAGAACTGTGTTATGTGG - Intergenic
1139657071 16:68395334-68395356 TTCCCAAGAAGTGTGAAATGAGG - Intronic
1141318691 16:82986276-82986298 AGCCCCAGAACTGGCTCATGTGG + Intronic
1142165257 16:88583418-88583440 TGCCCCAGAGCAGGGTGATGTGG - Intronic
1143944172 17:10575133-10575155 TGACCCAAAACTGGGTACTGGGG + Intergenic
1144945360 17:18966939-18966961 TGCCCCTGATCTGTGCCATGGGG - Intronic
1146827077 17:36032178-36032200 TGCCCAATAAATGTGGAATGAGG + Intergenic
1148537676 17:48454379-48454401 TTGGCCAGAACTGTGTCATGTGG - Intergenic
1154044351 18:10890272-10890294 TGCCTTAGAAATGTGTACTGTGG - Intronic
1154446753 18:14440916-14440938 TCTCCCAGAACTGTGTAAACCGG - Intergenic
1156260586 18:35442068-35442090 TGCCCACAAACTGCGTAATGCGG + Intergenic
1163856249 19:19704553-19704575 TGACCCAGGACTGTGTAAGAGGG + Intergenic
1166946869 19:46402777-46402799 TGCACCAGCACTGCGTGATGTGG - Intergenic
1166959904 19:46491112-46491134 TGCACCAGCACCGTGCAATGCGG + Intronic
1168659951 19:58157670-58157692 TGCCCAAGAGCTGCGGAATGCGG + Intergenic
925533038 2:4884578-4884600 TGCCCAAGGACTGAGGAATGTGG + Intergenic
928308193 2:30188585-30188607 TGCCCCAAAATTCTGTAACGGGG + Intergenic
929847673 2:45547383-45547405 TGCCCCAGAACTGTTTTATATGG + Intronic
930002956 2:46873598-46873620 TTCACCAGATCTGTGCAATGGGG - Intergenic
931067353 2:58601349-58601371 TGCCCCAAAACTGACTGATGTGG - Intergenic
935434968 2:103020498-103020520 GGCCTCTGAGCTGTGTAATGAGG - Intergenic
938256689 2:129864798-129864820 TGCCACAGATCTGTTTGATGGGG + Intergenic
938483194 2:131679311-131679333 TGTCCCAGAACTGTGTAAACCGG + Intergenic
939656709 2:144835293-144835315 TTCTTCAGAACTGTGAAATGAGG - Intergenic
945832190 2:214800819-214800841 TGCTACAGAACTGTGGAACGAGG + Intronic
945961262 2:216137340-216137362 TGCCCCAGAACTACACAATGAGG - Intronic
946964872 2:225027070-225027092 TTCCCTAGTACTGTGTACTGAGG - Intronic
1170731963 20:18983735-18983757 GGCCCCACACCTGTGGAATGGGG + Intergenic
1171185133 20:23119636-23119658 TGCACCAGAATTCTGCAATGGGG + Intergenic
1175192541 20:57221280-57221302 TGTCCCAGTAGTGTGTAGTGAGG - Intronic
1175735115 20:61380365-61380387 TGGCCCAGAACTGGGTAAAACGG - Intronic
1175803358 20:61813619-61813641 TGGCTCAGGGCTGTGTAATGGGG + Intronic
1176449220 21:6848924-6848946 TCTCCCAGAACTGTGTAAACCGG + Intergenic
1176827388 21:13713948-13713970 TCTCCCAGAACTGTGTAAACCGG + Intergenic
1177768346 21:25485243-25485265 TTCCCCAGAACCATGTATTGAGG - Intergenic
1177898489 21:26883954-26883976 TGCTCCAGCACTGTGTCATCAGG - Intergenic
1181997086 22:26891642-26891664 TCCCCCAGAAATGTGGAATGAGG + Intergenic
1182733044 22:32510726-32510748 TGCCCCAGATCCTTCTAATGGGG + Intergenic
1183576705 22:38695299-38695321 TGCTCAAGGACTATGTAATGGGG + Intronic
1184829717 22:46976870-46976892 TGAGCCAGAACTGTGTGCTGGGG + Intronic
951431744 3:22615953-22615975 AGACCCAGAACTGGTTAATGAGG - Intergenic
954144901 3:48629688-48629710 TGCCCCAGGACAGAGTAGTGGGG + Exonic
957243415 3:77688121-77688143 GTCCCCAGAACTGTAAAATGGGG + Intergenic
957737998 3:84226833-84226855 TGCCCCAGGGCTGTGTTTTGTGG - Intergenic
965430415 3:168580340-168580362 TGCCCCATGACTGTGTTCTGTGG - Intergenic
965442133 3:168727764-168727786 TGACCCAGAACTGTGAAGTAAGG + Intergenic
967805101 3:193708735-193708757 TGTGCCAGGACTGTGTTATGGGG - Intergenic
970243446 4:14033314-14033336 TGCCCCAACACTGTTTATTGAGG + Intergenic
970367130 4:15371317-15371339 CGCCCAAGAACAGTCTAATGAGG - Intronic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980081399 4:128348323-128348345 TGTCCCAGAAATATGCAATGTGG - Intergenic
980371447 4:131879432-131879454 TGCCCCAGAAAAATGGAATGAGG - Intergenic
984173242 4:176385741-176385763 TGCCCCATAATTGTGTGCTGAGG - Intergenic
1001197536 5:169686887-169686909 TGCCCAAAAATTGTGTGATGAGG + Intronic
1002989213 6:2222448-2222470 TACCCAATAATTGTGTAATGAGG - Intronic
1004688345 6:17969737-17969759 TACCCCAGAACTGTTTACTTGGG + Intronic
1006306454 6:33223568-33223590 TTCCCCAGGACTGTTTATTGAGG - Intergenic
1011161540 6:84396389-84396411 TGCCCCAGGCCTGTGCCATGAGG - Intergenic
1011207819 6:84919644-84919666 TGCACAAGAATAGTGTAATGTGG + Intergenic
1012815732 6:104019408-104019430 TGCCCCAGAAATGTGCAACCAGG - Intergenic
1013017772 6:106176663-106176685 TGCCCCATATCTGTGTTTTGTGG - Intergenic
1014103971 6:117542636-117542658 AGCCCCAGAGCTCTGTAACGAGG + Intronic
1016903953 6:149130849-149130871 GGCCCCAGAGCTCTGCAATGGGG + Intergenic
1019597405 7:1864517-1864539 TGCCCAGCAACTGTGTCATGGGG - Intronic
1022780988 7:33582945-33582967 TGGTCCAGAACTAAGTAATGTGG + Intronic
1022904996 7:34847193-34847215 TCCGTCATAACTGTGTAATGTGG - Intronic
1023746223 7:43325429-43325451 TGCCCCAGAACACTGAGATGAGG + Intronic
1025008897 7:55379402-55379424 TGGGTCAGAACTGTGTCATGTGG + Intronic
1027271252 7:76520293-76520315 TTCCCCAGGACTGTGTAGTTGGG + Intergenic
1029590381 7:101503153-101503175 GGCCCCAGAACTGGGTGTTGGGG + Intronic
1029843540 7:103390414-103390436 TGCCCCAGGTGTGTGTAATGTGG - Exonic
1033662109 7:143409181-143409203 GGCCCCAGAGCTGGGTAATAGGG + Intergenic
1033719055 7:144037587-144037609 TGCCCCACAGCTGTGTAACCAGG + Intergenic
1034971007 7:155419085-155419107 GGCCCCAGAACCATGTGATGAGG + Intergenic
1036965915 8:13298290-13298312 TGCCACAGAAACGTGTAAAGGGG - Intronic
1037663303 8:20944944-20944966 AGCCCCAGAACTGTGGGATGTGG - Intergenic
1044310598 8:90687764-90687786 TTCCCCAAAATTCTGTAATGGGG + Intronic
1044803830 8:95984292-95984314 TTCCCCAGAACTGGAGAATGAGG + Intergenic
1050589289 9:7145822-7145844 TGCCCCATGACTGAGAAATGAGG - Intergenic
1053442623 9:38128554-38128576 TGCCCCATGACTGTGTTTTGGGG + Intergenic
1055100137 9:72455689-72455711 TTCCCCAGAACTAAGAAATGAGG - Intergenic
1056781470 9:89554297-89554319 GGCTCCAGAGCTGTGTGATGTGG - Intergenic
1057769529 9:97955342-97955364 TGGTCTAGAACTTTGTAATGAGG + Intergenic
1058800903 9:108543606-108543628 TGTCCCAGGTCTGAGTAATGGGG - Intergenic
1059280314 9:113127294-113127316 TTGGCCAGAACTGTGTCATGTGG + Intergenic
1203519968 Un_GL000213v1:35592-35614 TCTCCCAGAACTGTGTAAACCGG - Intergenic
1187238717 X:17493327-17493349 TGTCCCAGAAGTGTGGACTGGGG + Intronic
1187300388 X:18043520-18043542 AGCCACAGAAATGTGTAGTGTGG + Intergenic
1188387658 X:29581485-29581507 TGCCACAGAACTGTCAGATGGGG + Intronic
1189913289 X:45832671-45832693 TTCCCCAGAACTGAGTAAACGGG - Intergenic
1198193497 X:134335382-134335404 TGCCCCAGAACTCTGGTATAAGG + Intergenic
1198379090 X:136067490-136067512 TGATCCAGAACTGGGTAGTGAGG - Intergenic
1199145396 X:144360231-144360253 TGCCCCTGAACTGTGTCATGGGG + Intergenic
1199262777 X:145795069-145795091 TCCCCCAGAACTGGGTCATATGG - Intergenic
1199783444 X:151083385-151083407 TGCTCCAGATTTGTGGAATGAGG - Intergenic
1200362558 X:155625065-155625087 TGCCTCAAAGCTGTGAAATGTGG - Intronic