ID: 906689745

View in Genome Browser
Species Human (GRCh38)
Location 1:47784775-47784797
Sequence CCTGCTTTGCAGGCCGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906689740_906689745 -8 Left 906689740 1:47784760-47784782 CCGAGCTTCCTTTCTCCTGCTTT 0: 1
1: 0
2: 6
3: 89
4: 1166
Right 906689745 1:47784775-47784797 CCTGCTTTGCAGGCCGCCCAGGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906689745 Original CRISPR CCTGCTTTGCAGGCCGCCCA GGG Intronic
900880620 1:5378460-5378482 CCTGCTTTCTTGGCCTCCCAGGG + Intergenic
904388615 1:30164220-30164242 CATGTTTTGCAGGCAGTCCAAGG + Intergenic
904780377 1:32942302-32942324 CCAGCTTTGCAGCCCTCTCAGGG - Exonic
906689745 1:47784775-47784797 CCTGCTTTGCAGGCCGCCCAGGG + Intronic
907255990 1:53179608-53179630 CCTGCTTTGAAAGGAGCCCATGG + Intergenic
912701030 1:111878424-111878446 CCTGCTGTGGCGCCCGCCCAAGG + Intronic
924605524 1:245531453-245531475 CCTTCTCTGCTGGCCTCCCAGGG + Intronic
1063320254 10:5045685-5045707 CCTGCTTTGCAGGTCTTTCAGGG + Intronic
1063410620 10:5833909-5833931 CCTCCTTTGGAGGCTGCCCCTGG - Intronic
1065893968 10:30145186-30145208 CCTCCTCTGCAGGTCTCCCATGG - Intergenic
1065937861 10:30536766-30536788 CCTGCTTTGCAGCTTGCCCCAGG - Intergenic
1067090230 10:43262691-43262713 CCTGCTGTGCAGGGGGCCCGGGG - Intronic
1067096468 10:43304716-43304738 CCAGCTCCGCAGGCGGCCCACGG - Intergenic
1067727205 10:48779283-48779305 CATGCTTGGCATGGCGCCCAGGG + Intronic
1067769922 10:49115590-49115612 CCCGCGTGGCAGGCGGCCCAAGG - Intergenic
1069904675 10:71725300-71725322 CCTGCTGTGCTGGCCTGCCATGG - Intronic
1070385090 10:75917143-75917165 CCTGCTGTGCAGGCCATCAATGG + Intronic
1071717375 10:88110909-88110931 CCTGCTTTGCTGGCAGTACATGG - Intergenic
1073873143 10:107889224-107889246 CCTGCCTTGCAGGCTGCCTTTGG + Intergenic
1076366026 10:129921594-129921616 CCACCTTTGCAGCCAGCCCACGG + Intronic
1076433686 10:130425169-130425191 CCTGCCCTGCAGACCACCCAGGG - Intergenic
1076882956 10:133248387-133248409 CCAGCTGTGGAGGCCGCCCCAGG - Intergenic
1079541025 11:21574694-21574716 CCTGCTTGGGAGGCCTCCCTGGG - Intronic
1081995618 11:47361827-47361849 CCTGCTTTGCAGTATGACCATGG + Intronic
1083815635 11:65130887-65130909 CCTGCTGTGCAGGCTCCCCAGGG + Intronic
1084367746 11:68713958-68713980 CCTGCTTTGAAGTCAGCACAGGG - Intronic
1084410958 11:69005670-69005692 CCTGCTCTGCTGCCCGCTCATGG - Exonic
1084443984 11:69192846-69192868 CCTCCTTTGCAGGCCCTCCTGGG + Intergenic
1087218227 11:95517888-95517910 CCTGCTTTGCAAACAGCCAATGG + Intergenic
1091304547 11:134529317-134529339 CCTGCCTTGCAGGCAGTCCTGGG + Intergenic
1091488914 12:916238-916260 CCTGGTTTGGAGCCGGCCCAGGG + Intronic
1092934711 12:13350033-13350055 ACTGCTTTGAAGCCAGCCCAGGG - Intergenic
1094304825 12:29006870-29006892 CCTGATTTCCAGGCCTCCAAGGG + Intergenic
1094646249 12:32327585-32327607 GCTGCTTTGCAGGCCCCTCATGG - Exonic
1096993304 12:55822288-55822310 CCTGCTTTTTAGGACACCCAGGG - Intronic
1098888500 12:75984048-75984070 CCTGCTAGGCAGGCCGGGCATGG + Intergenic
1100447697 12:94676512-94676534 TCTGCTTTGCAGGCCAACCCTGG - Intergenic
1104715923 12:131016130-131016152 CCTTCTGTGCAGGCCGCAGAGGG - Intronic
1105392976 13:19999013-19999035 GCTGTTCTGCAGGCCTCCCATGG - Intronic
1111999229 13:95194309-95194331 GCTGCTTTGGTGGCAGCCCAAGG - Intronic
1114083104 14:19218637-19218659 CCTGCTCTGCAGGTCTCACAGGG - Intergenic
1121313734 14:92948960-92948982 CCGGCTTTGCAGGACACACAGGG + Intronic
1122554671 14:102571308-102571330 CCTGCTTTGCAGGCTGGGCTGGG + Intergenic
1122689452 14:103524869-103524891 CCTGCTTCCCAGGTCCCCCATGG + Intergenic
1123977138 15:25564394-25564416 CCTGCTTTTGAGGCCTCACATGG + Intergenic
1124250620 15:28104568-28104590 CCTCCTGTCCAGGCCACCCAGGG + Intergenic
1125541234 15:40471152-40471174 CCCGCCTTCCAGGCCGCCCTCGG + Exonic
1127471665 15:59295759-59295781 CCTGCTTTGGAGGACCCCAAAGG + Intronic
1127953578 15:63833719-63833741 TGTGCTTTGCCGGCCGCGCAGGG - Intronic
1129086029 15:73093335-73093357 CCTGAAGTGCAGGCTGCCCATGG - Intronic
1131971000 15:97892652-97892674 CTTGCTTTGCAGACAGGCCATGG + Intergenic
1132787774 16:1667534-1667556 CCTGCTGTGCCGACTGCCCAGGG + Intronic
1135112155 16:19698743-19698765 CCTGCTGTTCAGGAAGCCCATGG - Intronic
1135661633 16:24302092-24302114 GCTGCTTTCCAGGCTGCCCAAGG - Intronic
1136189388 16:28606654-28606676 CCTGCTGTGGGGGCTGCCCAGGG + Intronic
1136651584 16:31677628-31677650 CCAGCTGAGCAGGCTGCCCATGG - Intergenic
1136713533 16:32259210-32259232 CCTGTTGTGCAGGCCTCACAGGG - Intergenic
1136754378 16:32670221-32670243 CCTGTTGTGCAGGCCTCACAGGG + Intergenic
1136813735 16:33200144-33200166 CCTGTTGTGCAGGCCTCACAGGG - Intronic
1136820211 16:33310224-33310246 CCTGTTGTGCAGGCCTCACAGGG - Intergenic
1136826774 16:33366763-33366785 CCTGTTGTGCAGGCCTCACAGGG - Intergenic
1136831840 16:33465534-33465556 CCTGTTGTGCAGGCCTCACAGGG - Intergenic
1136997601 16:35201418-35201440 CCTGTTGTGCAGGCCTCACAGGG + Intergenic
1137223851 16:46482635-46482657 CCTGGTCTGCATGCAGCCCATGG - Intergenic
1138513440 16:57522034-57522056 CCTGATGGGCAGGACGCCCAGGG - Intronic
1139546570 16:67652675-67652697 CCAGCTTTGCAGGTTGCACAAGG - Intronic
1140420100 16:74812388-74812410 CCTGCATTGCCAGCCTCCCAAGG + Intergenic
1141098109 16:81177285-81177307 GCTGCTTTGCAAGCAGCCCCAGG - Intergenic
1142125144 16:88406444-88406466 CCTGCCGTGCGGGCTGCCCATGG + Intergenic
1202992311 16_KI270728v1_random:23118-23140 CCTGTTGTGCAGGCCTCACAGGG - Intergenic
1203056525 16_KI270728v1_random:930552-930574 CCTGTTGTGCAGGCCTCACAGGG + Intergenic
1142478902 17:206042-206064 CCTGCCCTGCACTCCGCCCATGG - Intergenic
1142667308 17:1470397-1470419 CCTGCTCTGCAGCCCCCACAAGG + Intronic
1145217268 17:21061534-21061556 CCGGCTTTGGAGGGCTCCCAGGG + Intergenic
1145960620 17:28884682-28884704 CCTGCTGTGCAGGCCATCCGTGG + Intronic
1147257730 17:39192044-39192066 CCTGCGGAGCAGGCCGTCCACGG - Intronic
1147374744 17:40016816-40016838 CCTGCCCTGCAGCCCACCCAGGG + Exonic
1148667571 17:49386328-49386350 CCTTCTTTGTAGGCCGGGCATGG + Intronic
1149076531 17:52602066-52602088 CCTGCTATGCAGCCTGTCCATGG + Intergenic
1152322310 17:79614467-79614489 CCAGCTTTGCAGCCCCCCTAAGG + Intergenic
1152828294 17:82481166-82481188 CCTGCTTTGCATGGCTCCCGGGG + Exonic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155165941 18:23232563-23232585 GCTGCTATGCAGGCACCCCAGGG - Intronic
1157577322 18:48752227-48752249 GCAGCTTGGCTGGCCGCCCACGG + Intronic
1159189082 18:65017863-65017885 CCTGCTTTCCATGGTGCCCATGG + Intergenic
1159492666 18:69158816-69158838 TCTGCTTTGAAGGCTCCCCAAGG + Intergenic
1163419392 19:17205736-17205758 CTTCCTTTGTAGGCCACCCAAGG - Intronic
1164250472 19:23470844-23470866 CCTTCTTTCCTGGGCGCCCAAGG - Intergenic
1168307055 19:55441467-55441489 CCTGCCCTGCAGGCCACCGAGGG + Intronic
926592746 2:14757378-14757400 TCTGCTTTGAAAGCCTCCCAGGG - Intergenic
929580844 2:43080993-43081015 CCTGCATGGCAGGCAGGCCATGG + Intergenic
931175469 2:59850076-59850098 CAAGCTCTGCAGGCCGCCCCAGG - Intergenic
931785066 2:65611086-65611108 CCTTCTTTGGAGGATGCCCATGG + Intergenic
933186163 2:79281209-79281231 TTTGCTTTGCAGGCCACCCTTGG - Intronic
934508491 2:94916730-94916752 GTTTCTTGGCAGGCCGCCCATGG - Intergenic
940203607 2:151177857-151177879 ACAGTTTTGCAGGCCACCCAAGG + Intergenic
940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG + Intergenic
940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG + Intergenic
941439375 2:165514376-165514398 CTTCCTTTGCAGGCCCCCCTGGG - Intronic
942093299 2:172514593-172514615 CCAGCTCTGCAGGTGGCCCACGG + Intergenic
944644714 2:201767258-201767280 ACTGTTTTGCAGGCAGCCCTCGG - Exonic
948632843 2:239313010-239313032 CTTGCTCTGCAGGCTGCCCCCGG - Intronic
948797041 2:240410769-240410791 CCTGCTTTGCCGCTTGCCCAGGG - Intergenic
1169288060 20:4326027-4326049 CCTGCTCTGCTGGCCACCCTTGG - Intergenic
1170359455 20:15528560-15528582 CCTTCTTGGCAGGGCTCCCAAGG - Intronic
1171271406 20:23821374-23821396 CCTGCTTCCCAGGCCTCCAATGG + Intergenic
1171413238 20:24960370-24960392 CCTGAGTTTCAGGCCTCCCAGGG + Intergenic
1173419646 20:42889675-42889697 CCTGCTTTGCTGGGAGCCCAAGG - Intronic
1175428761 20:58888856-58888878 CACACTTTGCACGCCGCCCAGGG + Intronic
1179315448 21:40240109-40240131 TCTGCATTGCAGGGGGCCCAGGG - Intronic
1180497675 22:15904044-15904066 CCTGCTCTGCAGGTCTCACAGGG + Intergenic
1181897289 22:26121650-26121672 TCTGCTTATCAGGCTGCCCAGGG - Intergenic
1184775185 22:46619620-46619642 CCTTCTTTGCTGGCCGCCCCCGG + Intronic
1185014247 22:48334077-48334099 CCATCTTTGCTGGGCGCCCAGGG + Intergenic
1185121010 22:48970108-48970130 GCTTCTTTGCAGGCCACACAGGG + Intergenic
1185370338 22:50457964-50457986 CCTGCTTTGGACGCCAACCAGGG + Intronic
952094172 3:29928534-29928556 TTTGCTTTGCAGGGCCCCCATGG - Intronic
954388194 3:50255340-50255362 CCTGCTTGGCAGGGGTCCCAGGG - Intronic
954430027 3:50465724-50465746 CATGCCTTGCAGGCAGGCCAGGG - Intronic
960964282 3:123093952-123093974 CATGTTTTCCAGGCCGCTCAGGG - Intronic
961057779 3:123803720-123803742 CCTGCTTGGCGGGCAGCCCTGGG - Intronic
961605012 3:128087119-128087141 GCAGCTTTGGAGGCCGCCCCTGG - Intronic
961637189 3:128341020-128341042 CCTGCTTTGCTGGCGGCCCTCGG + Intronic
968085214 3:195871068-195871090 CCTGCTTTCCACGCCTCTCAGGG + Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
976390150 4:84498145-84498167 CATGCTGTGCAGGGCGGCCAGGG + Exonic
985275351 4:188233004-188233026 TCTGGGTTGCAGGCAGCCCATGG + Intergenic
986574619 5:9199074-9199096 CCTGCTTTGCATGGGGCCCCAGG + Intronic
987359188 5:17091582-17091604 CCTGCTTTACAGTCGGTCCAGGG - Intronic
995836226 5:116402409-116402431 CCTTCTGTGCAGGGCGCCCTGGG + Intronic
997261207 5:132466697-132466719 GCTGCTGTGCAGGCGGCCCCAGG - Intronic
999077764 5:148813115-148813137 CCTGGGTTGCAGGTGGCCCACGG - Intergenic
1000081605 5:157853484-157853506 ACTGCTTTGTAGGCCGGGCACGG + Intronic
1000418566 5:161010843-161010865 CCTTCTTTGCAGACCTCCTAAGG - Intergenic
1001236615 5:170035149-170035171 GCTGCTTGGCAGCCAGCCCATGG - Intronic
1002961010 6:1914961-1914983 CCTGACTTGCAGACCTCCCAAGG - Intronic
1004275461 6:14231744-14231766 CATCCTTGGCAGGCAGCCCAGGG + Intergenic
1004285726 6:14318805-14318827 CCTGCATTGCAGGCCACCAGGGG - Intergenic
1008827537 6:55715663-55715685 CCTGGTTTGCATGTGGCCCACGG - Intergenic
1013225718 6:108118411-108118433 CCTGCCTCGCCGGCGGCCCACGG + Intronic
1018091164 6:160348033-160348055 CCTGCTCTGCAGTCAGCCCCAGG - Intergenic
1021621064 7:22551432-22551454 CCTTCCTTTCAGGCCTCCCAAGG + Intronic
1022826614 7:34020803-34020825 CCTGCTTTGCAGGCAGCATGGGG + Intronic
1023428569 7:40065547-40065569 CCTGGGTTGCATGCAGCCCATGG + Intronic
1025142782 7:56479430-56479452 CCTGTTGTGCAGGCCTCACAGGG + Intergenic
1029402724 7:100355791-100355813 CCTGCTTACCAGGCTGCCCAAGG - Intronic
1033254132 7:139784957-139784979 CCTTCGATGCAGGCAGCCCAAGG - Intronic
1035265059 7:157685691-157685713 CCTGCTTTGGAGGCCTCCCTTGG + Intronic
1035363266 7:158328307-158328329 CCTGCCTTGGACGCAGCCCACGG - Intronic
1035467870 7:159091557-159091579 CCTGCCTCGCAGGGGGCCCAGGG + Intronic
1041404189 8:57479705-57479727 CCTGTTTTGCAGGCAACCTACGG - Intergenic
1042516096 8:69661251-69661273 CCTGATTTGCAGGGCCCCCGTGG - Intergenic
1048301864 8:133257103-133257125 GCTGCTTTGCAGGCCTGCCTTGG + Intronic
1049642568 8:143722129-143722151 TCTGCCTTGCAGGGTGCCCAGGG + Exonic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1061226260 9:129282796-129282818 CCTGCTAGGGAGGCTGCCCAAGG - Intergenic
1061886245 9:133592383-133592405 CCTCCCTCTCAGGCCGCCCAGGG - Intergenic
1062088635 9:134662276-134662298 CCTGACTTCCAGGCCGCTCAGGG + Intronic
1062501151 9:136852593-136852615 CCCCCCTTGCAGGCCGGCCAAGG - Intronic
1189195263 X:39147314-39147336 CCTTCTTTGCAGGTCTCCCCTGG - Intergenic
1190055951 X:47181203-47181225 CCTGCCCTTCAGGCCTCCCAAGG + Exonic
1192436928 X:71148737-71148759 GCTGCTCTGCAGGCGGCACATGG - Intronic
1193121213 X:77824506-77824528 CCTGGGTTGCATGCGGCCCATGG + Intergenic
1194486504 X:94492881-94492903 CCAGCTTTGCAGGCGGCCCACGG + Intergenic