ID: 906693529

View in Genome Browser
Species Human (GRCh38)
Location 1:47809064-47809086
Sequence TCCTCTGCACGTCCTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906693518_906693529 16 Left 906693518 1:47809025-47809047 CCCAGGCTGACGAAACCTTGCTC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 147
906693522_906693529 -6 Left 906693522 1:47809047-47809069 CCCTGCCCAGGATCCCCTCCTCT 0: 1
1: 0
2: 1
3: 57
4: 580
Right 906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 147
906693523_906693529 -7 Left 906693523 1:47809048-47809070 CCTGCCCAGGATCCCCTCCTCTG 0: 1
1: 1
2: 4
3: 48
4: 465
Right 906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 147
906693519_906693529 15 Left 906693519 1:47809026-47809048 CCAGGCTGACGAAACCTTGCTCC 0: 1
1: 0
2: 1
3: 3
4: 90
Right 906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 147
906693521_906693529 1 Left 906693521 1:47809040-47809062 CCTTGCTCCCTGCCCAGGATCCC 0: 1
1: 0
2: 6
3: 63
4: 560
Right 906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906693529 Original CRISPR TCCTCTGCACGTCCTCTGTC TGG Intronic
900322888 1:2093755-2093777 TACACAGCACGTCCTCTGTGAGG - Intronic
900946814 1:5835417-5835439 TCCTGAGCACGACGTCTGTCAGG + Intergenic
900981868 1:6050282-6050304 CCCTCTGCACCTTCTCTCTCTGG + Intronic
903027947 1:20442913-20442935 TCCTCAGAACATCCTCTCTCAGG - Intergenic
903249881 1:22045108-22045130 CCCTCTCCAGGCCCTCTGTCTGG - Intergenic
904954697 1:34273262-34273284 TGCTCTGCAGGTCATGTGTCTGG + Intergenic
904975286 1:34451533-34451555 TCCTGTGCACCTGCTCTGCCAGG + Intergenic
905007185 1:34719231-34719253 TGCTCTGCACCTCCTCTTTCAGG + Intronic
905158895 1:36014015-36014037 TTCTCTGCACTGCCTCTGTGTGG - Exonic
906693529 1:47809064-47809086 TCCTCTGCACGTCCTCTGTCTGG + Intronic
908034330 1:60035510-60035532 TCCTCTTCTCATGCTCTGTCAGG - Intronic
915491372 1:156251790-156251812 TCCTCTGCATCTGCTCTGGCTGG - Intronic
918058270 1:181041481-181041503 TCCTCTCCACATTCTCTGTCTGG + Intronic
920294179 1:204945831-204945853 TCCTCTGCACACCCTCCCTCCGG - Intronic
920835759 1:209509377-209509399 TCATCTGGACATCATCTGTCAGG - Intergenic
1065919338 10:30378384-30378406 TCCTCTACAAGTCCTGTGTTTGG - Intergenic
1067043938 10:42974179-42974201 TCCTCAGCACATCCCCTGCCAGG - Intergenic
1069898253 10:71692187-71692209 TGCTCTGCGAGTCCTCAGTCAGG - Intronic
1072922630 10:99589274-99589296 CCCTTTTCACGTCATCTGTCTGG - Intergenic
1075317441 10:121464392-121464414 TCCTCTGCATGTCATCTGTGCGG + Intergenic
1076033022 10:127175528-127175550 TCCTCCGCTCGTCATCTGCCGGG + Exonic
1076181409 10:128411766-128411788 TCCTCTGCTCCTCCTCTTTCTGG - Intergenic
1076898427 10:133325390-133325412 TCTCCTGCGCGTCCTCTGCCGGG - Intronic
1077352437 11:2099160-2099182 TCCACTCCAGGTGCTCTGTCCGG - Intergenic
1077896847 11:6459372-6459394 TCCTCTTCACCCCCTCTGTGTGG + Intronic
1078348515 11:10573218-10573240 TCCTCTCCATTTACTCTGTCAGG + Exonic
1081780912 11:45711737-45711759 TCCTGTGCACATTTTCTGTCTGG - Intergenic
1081857366 11:46312354-46312376 TCCGCTTCTCCTCCTCTGTCAGG - Exonic
1083821606 11:65174627-65174649 TCCTCTGCTCGTCTGCAGTCAGG - Intergenic
1083829077 11:65219591-65219613 TCCCCTGCAGGGCCTCTGCCTGG - Intergenic
1084461467 11:69298879-69298901 TCCACCCCACGGCCTCTGTCAGG + Intronic
1086841656 11:91692893-91692915 TCCTCTGAGCGTCCTCTGAAAGG - Intergenic
1091284618 11:134401784-134401806 TCCTCTGCCCTTCCTCTCCCAGG - Intronic
1096157895 12:49351409-49351431 GCCTCTGTGCCTCCTCTGTCTGG - Exonic
1096591726 12:52664605-52664627 TCCTGTGCACGTTCTCAGCCGGG + Intergenic
1101604215 12:106235491-106235513 CCCCCTGCATGTCCTCTCTCTGG - Intergenic
1107032877 13:35871162-35871184 CCCTCTGCTCATCCTGTGTCAGG + Intronic
1108123492 13:47215064-47215086 TCCCCTGCTTGTCCTCTGTTGGG - Intergenic
1109563236 13:64077994-64078016 TTCTCGGCACCTCCTCTGCCTGG - Intergenic
1113319089 13:109214659-109214681 TTCTCTGGAAGTTCTCTGTCGGG - Intergenic
1113531157 13:111028607-111028629 ACCTCTGCAGGGCCTCTGTGGGG - Intergenic
1113598673 13:111552945-111552967 TCCATTGCACCTCTTCTGTCTGG + Intergenic
1117024940 14:51609534-51609556 TCCTCTGCCCCTTCTCTGCCTGG - Intronic
1119390233 14:74286772-74286794 CGCTCTCCACTTCCTCTGTCAGG + Exonic
1120880188 14:89409660-89409682 TCTTCTCCACGTTCTCAGTCTGG + Intronic
1121421443 14:93818585-93818607 TCCTCTGCACAGCCTCTGCATGG + Intergenic
1122945600 14:105007269-105007291 TCCTCTGCAAGGCCCCTGCCGGG + Intronic
1124190058 15:27566689-27566711 TCCTCTGCACTCCAGCTGTCTGG - Intergenic
1125421717 15:39511045-39511067 TCCCCGACACGTCATCTGTCAGG - Intergenic
1128573106 15:68750160-68750182 CACTCTGAACGTCCTCTCTCTGG + Intergenic
1131609725 15:93948041-93948063 TCCACTGGAGGTCCTCTCTCAGG - Intergenic
1131795801 15:96015426-96015448 TCCTCTGCTTGCTCTCTGTCTGG - Intergenic
1132415472 15:101615833-101615855 TCTTCTGCAAGACCTGTGTCCGG + Intergenic
1134135901 16:11676185-11676207 TGCTCTCCTCGTCCTCTGACTGG - Exonic
1138599801 16:58047639-58047661 GCCTCTGCAAGTCCTCAGGCAGG + Intergenic
1140862027 16:79026297-79026319 GCCTTTGCACATCCTCTGCCGGG + Intronic
1148460509 17:47836811-47836833 TCCTCAGCAGGTGCTCTGTCAGG - Exonic
1154052034 18:10970206-10970228 TACTCTGCCAGTCCTCTGCCAGG - Intronic
1157319508 18:46623600-46623622 TCCTCTGCAGGCCCTGTGGCAGG + Intronic
1157335048 18:46731950-46731972 CGCTCTGCTCGTTCTCTGTCTGG - Intronic
1160593286 18:79956733-79956755 TCCTCTGAAGGGCCTGTGTCTGG + Intergenic
1161577411 19:5062102-5062124 TCCTCTTCCTGCCCTCTGTCCGG + Intronic
1162786771 19:13040005-13040027 TCCACTGCCCCTCCTCTGTCAGG - Intronic
1163366099 19:16876889-16876911 ACCTCTGCACCTCTTGTGTCAGG + Intronic
1163659558 19:18568598-18568620 TCATCTCCTCGTCATCTGTCTGG - Exonic
1164578336 19:29419024-29419046 CCCTCTGCCCTTCCTGTGTCTGG + Intergenic
1166997492 19:46726685-46726707 TACTCTGCTCGTCATCTCTCCGG - Intronic
927937081 2:27082186-27082208 CCCTCTGCACATCCTCTGCCAGG - Exonic
928123537 2:28600995-28601017 TCCTCCACAGGACCTCTGTCAGG - Intronic
928294159 2:30068399-30068421 ACCTCTGGACATCCTTTGTCAGG + Intergenic
928892116 2:36216282-36216304 ACCTCTGCAGTGCCTCTGTCTGG - Intergenic
935373237 2:102369261-102369283 TCCTCTCAACGTGCTCTCTCAGG - Intronic
936624638 2:114135622-114135644 TCCTCTCCATGTCCTCACTCCGG + Intergenic
936897716 2:117446752-117446774 TCCCCTGCACATGCTCTCTCTGG + Intergenic
937427837 2:121814652-121814674 TCCTCTGCAAGGCCTCGCTCAGG - Intergenic
938117469 2:128611782-128611804 ACCTCTGCAGGTCCCCTGTGGGG + Intergenic
939844543 2:147227638-147227660 TCCATTGCAATTCCTCTGTCTGG - Intergenic
940344986 2:152619655-152619677 CCCTCTGCACCTCCGCTGCCTGG + Exonic
941921834 2:170858922-170858944 TCCTCTGCAATTTCTCTGGCTGG + Intronic
945988300 2:216371897-216371919 TCCTCTCCACCGCCTCTGGCTGG + Exonic
948335311 2:237202700-237202722 ACCGCTCCACGTCCCCTGTCTGG - Intergenic
1168812817 20:717313-717335 TGCTCTGCACTTTCTCTCTCTGG + Intergenic
1170711406 20:18794470-18794492 AACGCTGCACATCCTCTGTCTGG - Intergenic
1172006899 20:31824027-31824049 TCCTGTGCACGTGGTCTGTGTGG + Intronic
1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG + Exonic
1175244029 20:57570672-57570694 TCCTCTGCAGGCATTCTGTCCGG - Intergenic
1175870547 20:62207574-62207596 TCCTCTGTACGGCCTCTTCCTGG - Intergenic
1175966103 20:62660960-62660982 TCCTCTGCCCCTCCCCGGTCTGG - Intronic
1179944737 21:44665426-44665448 TCTTCTGCATTTCCCCTGTCTGG - Intronic
1181536432 22:23548691-23548713 TCATCTGAACCTCCTCTGTGAGG - Intergenic
1181802900 22:25358827-25358849 TCCACTGCACCTCCTCCCTCAGG + Intronic
1182577834 22:31285042-31285064 TCCTCTACACCTGCTCTCTCTGG - Intronic
1185212165 22:49576451-49576473 CCCTCTCCCCGTCCTCTGACAGG + Intronic
1185308619 22:50139300-50139322 ACATCTGCACGTCCTCTGTTTGG + Intronic
949334979 3:2964872-2964894 TCCCCTTCACATCATCTGTCTGG + Intronic
950690166 3:14649397-14649419 TCCTCTGCACGATGCCTGTCAGG - Intergenic
953799912 3:46014877-46014899 TCCTCTGCATGTCTTCAGTTAGG + Intergenic
956018266 3:64907374-64907396 GCCTCTGGAAGACCTCTGTCAGG + Intergenic
957060261 3:75475706-75475728 TCCTCTTCTCCTCTTCTGTCTGG - Intergenic
960403188 3:117228932-117228954 TCCTTTCCACATCTTCTGTCTGG - Intergenic
961874330 3:130010502-130010524 CTCTCGGCACCTCCTCTGTCTGG + Intergenic
966952395 3:184833605-184833627 TCCTCTGCATGGCATCAGTCTGG + Intronic
967229123 3:187320900-187320922 TCCTCTCCAGGTCCACTGGCTGG + Intergenic
967303871 3:188042192-188042214 TTCTCTGCAGGTGCTCTGCCTGG - Intergenic
968800935 4:2742908-2742930 TACTCTGCACCTCCTCTGTGGGG + Intronic
968892546 4:3377730-3377752 TCCTCTGCAGGCAGTCTGTCTGG - Intronic
969717362 4:8874200-8874222 TCCTCTGGGCGCCCGCTGTCTGG + Intergenic
971158634 4:24109917-24109939 TCTTCTCCACCTCCTCTGTGGGG - Intergenic
971341073 4:25769578-25769600 TCCCTTGCATGCCCTCTGTCTGG - Intronic
972022858 4:34336140-34336162 CTCTCTGCACCTCCTCTGCCTGG - Intergenic
973566643 4:52195378-52195400 TCCCCTGCAACTCCTCTGTCAGG + Intergenic
975110246 4:70615649-70615671 TCCTCTGCATGTCCTTTTTCTGG - Intergenic
981271062 4:142847110-142847132 TCCTCAGCCCGACCTCTGCCCGG - Intronic
981275749 4:142897364-142897386 CTCTCTGCACCTCCTCTGCCTGG + Intergenic
986614142 5:9599588-9599610 TCCCCTGCAGGTGGTCTGTCTGG - Intergenic
988672950 5:33401559-33401581 TCCTCTCCAGGTTGTCTGTCTGG - Intergenic
992156687 5:73962353-73962375 TCCTTTGGATGTCCTCTGTGTGG + Intergenic
994214972 5:97127526-97127548 CCCTCTGCACTTCATTTGTCTGG - Intronic
997597825 5:135118920-135118942 GCCTCTGCCTGTCCTCTGTCCGG - Intronic
998867031 5:146515766-146515788 TTGTCTGCAAGTCCTCTGACTGG - Exonic
1001002183 5:168017996-168018018 GCCTCTGCACTTCCACTGTTGGG + Intronic
1001034768 5:168290005-168290027 CCCTCTACACTTCCTCTGTTTGG - Intergenic
1001893195 5:175356413-175356435 TCCTCTGCAAGACCTTTGTAAGG - Intergenic
1002397554 5:178969906-178969928 TCCTCTGCCCGTCTCCTGCCGGG + Intergenic
1003060538 6:2859043-2859065 TCCCCTGCCCCTTCTCTGTCTGG + Intergenic
1005155690 6:22803606-22803628 TCCTCTGCTTTTCCTCTGTTAGG - Intergenic
1006069573 6:31488442-31488464 TCCTCTGCACGTCCTGGATGTGG + Intergenic
1007342515 6:41200638-41200660 TTCTCTGCTTGGCCTCTGTCAGG - Intronic
1007728741 6:43932988-43933010 TCCTCGGCATTTCCTCTGTGTGG + Intergenic
1011703299 6:89975573-89975595 TCCTCTGCCTGGCCGCTGTCTGG + Intronic
1012896575 6:104956208-104956230 TCCTCTTCACCTCCCCTGCCTGG + Intergenic
1014088945 6:117381158-117381180 TCCTCTGCAAATCCTCTCCCAGG - Intronic
1015920639 6:138263157-138263179 TTCTCTGCACGACATCTGGCTGG - Exonic
1016986789 6:149901240-149901262 TCTGCTCCACGGCCTCTGTCAGG - Intergenic
1018907028 6:168081418-168081440 GCCTCTGCCCGTCCACTGCCCGG - Intronic
1023838860 7:44084320-44084342 TCCTTTTAATGTCCTCTGTCTGG + Intergenic
1026006486 7:66604045-66604067 TCCTCTGCACCTCCACCTTCTGG - Intergenic
1027781005 7:82520387-82520409 TCCTCTTCATTTCCTCTGTGGGG - Intergenic
1031542684 7:123014248-123014270 TCTTTTCCAGGTCCTCTGTCCGG + Intergenic
1032458385 7:132091577-132091599 ACCTCTGCACCTCCGCTGGCTGG - Intergenic
1033039588 7:137905800-137905822 TCCTCTTCTCCTCCTCTGTCAGG + Exonic
1033419473 7:141193469-141193491 TCCTCTCCACTCACTCTGTCTGG + Intronic
1036923321 8:12879304-12879326 TTCTGTGCATTTCCTCTGTCAGG + Intergenic
1037877317 8:22554444-22554466 TCCTCTGCGTGTCCTCTGTGGGG - Exonic
1038068832 8:23991440-23991462 TCATCTGTACGTCCTGTCTCTGG + Intergenic
1039818624 8:41116703-41116725 TCCTCTCCACGTCCTTTATTAGG - Intergenic
1044839925 8:96328812-96328834 TCCTCTGCACAGCCACAGTCTGG - Intronic
1046649369 8:116819896-116819918 TGCTCTCCACATCCTTTGTCTGG + Intronic
1049065532 8:140310793-140310815 TGCTCTGCACTGCCTCTGCCTGG - Intronic
1049701770 8:144018065-144018087 TCCTCTACCTGTCCTCAGTCAGG - Intronic
1051559183 9:18421083-18421105 CCCTCTGCATTTCCTCTTTCAGG - Intergenic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1057905725 9:98981692-98981714 TCCTCTGCCCATGCTCTGGCAGG - Intronic
1061481444 9:130899298-130899320 CCCTGTGCTCGGCCTCTGTCTGG - Intergenic
1061678605 9:132231733-132231755 TCCCCTCCACGTCCACTGCCTGG + Intronic
1061713648 9:132504977-132504999 TCCCCAACACCTCCTCTGTCGGG - Intronic
1062339621 9:136088183-136088205 TGCTCTAAACGTGCTCTGTCCGG + Intronic
1062371379 9:136240901-136240923 CCCTCAGCCCGTCCTCTGTCAGG + Intronic
1188261515 X:28030421-28030443 TCCCCAGCCCATCCTCTGTCTGG - Intergenic
1192417586 X:70997291-70997313 GCCACTGCACTCCCTCTGTCTGG - Intergenic
1199175459 X:144783494-144783516 TTCTCGGCACCTCCTCTGCCTGG + Intergenic
1200474131 Y:3623596-3623618 CTCTCGGCACCTCCTCTGTCTGG - Intergenic
1200962543 Y:9008572-9008594 TCTTCTGCACAGCCTCTTTCAGG + Intergenic