ID: 906696614

View in Genome Browser
Species Human (GRCh38)
Location 1:47827696-47827718
Sequence CTCATTGTGGGCCAAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906696614_906696627 30 Left 906696614 1:47827696-47827718 CCAACACTTTGGCCCACAATGAG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 906696627 1:47827749-47827771 AACAAGGTTTGAGTCCACTTTGG 0: 2
1: 0
2: 0
3: 8
4: 111
906696614_906696618 -2 Left 906696614 1:47827696-47827718 CCAACACTTTGGCCCACAATGAG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 906696618 1:47827717-47827739 AGGTACCCCCCTTTTTAAACAGG 0: 1
1: 0
2: 0
3: 1
4: 59
906696614_906696626 14 Left 906696614 1:47827696-47827718 CCAACACTTTGGCCCACAATGAG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 906696626 1:47827733-47827755 AAACAGGAGGGATTTAAACAAGG 0: 2
1: 0
2: 3
3: 29
4: 328
906696614_906696619 1 Left 906696614 1:47827696-47827718 CCAACACTTTGGCCCACAATGAG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 906696619 1:47827720-47827742 TACCCCCCTTTTTAAACAGGAGG 0: 1
1: 1
2: 1
3: 6
4: 106
906696614_906696620 2 Left 906696614 1:47827696-47827718 CCAACACTTTGGCCCACAATGAG 0: 1
1: 0
2: 1
3: 12
4: 102
Right 906696620 1:47827721-47827743 ACCCCCCTTTTTAAACAGGAGGG 0: 1
1: 1
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906696614 Original CRISPR CTCATTGTGGGCCAAAGTGT TGG (reversed) Intronic
906696614 1:47827696-47827718 CTCATTGTGGGCCAAAGTGTTGG - Intronic
909091650 1:71233285-71233307 CTCAGTGTGGACCAAAGCCTGGG + Intergenic
909311719 1:74158931-74158953 CTGATGGTGGGCCAAAGTTCAGG - Intronic
915145518 1:153794050-153794072 CACATTGTGCGCCAAAGTGCGGG + Intergenic
915895509 1:159808549-159808571 CTCATGCTGGGCCAATGTGTGGG + Intronic
915920770 1:159973671-159973693 CTCATGCTGGGCCAATGTGTGGG - Intergenic
920787117 1:209051907-209051929 CTCTTTGTGGGGCAAAGAGAAGG + Intergenic
1064086841 10:12351472-12351494 CTCATTGGCGGCCACAGTGCGGG - Intronic
1066263782 10:33755074-33755096 CTAACTGTGGGCCACAATGTGGG - Intergenic
1070089538 10:73270909-73270931 CAAAGTGTGGGCCAAAGTATGGG - Intronic
1073083246 10:100872977-100872999 CTCATTGCGGGCTACAGTGCAGG + Intergenic
1073703649 10:105958228-105958250 CTCCCAGTGGGCCAAAGTTTTGG - Intergenic
1078640394 11:13090134-13090156 CTCATTGTTGGTGGAAGTGTGGG - Intergenic
1079351939 11:19699065-19699087 TTCACTGTGGGCCACAGAGTGGG - Intronic
1080894759 11:36439992-36440014 TTCATTGTGGGCCTAAGAGATGG + Intronic
1082706522 11:56499452-56499474 CTCACTGTGGACCAAAGCATTGG + Intergenic
1082707562 11:56511317-56511339 CTCACTGTGGACCAAAGTGTTGG + Intergenic
1083164504 11:60875230-60875252 CTACCTGTGGGCCCAAGTGTGGG - Exonic
1085369750 11:75989846-75989868 CTCACTGAGGGCCTCAGTGTTGG - Intronic
1086590556 11:88509468-88509490 CTCATTCTGGGCCCACGTGACGG + Exonic
1088371079 11:109089238-109089260 CTCATTGTAAGCCACAGTGAAGG - Intergenic
1088971348 11:114777076-114777098 ATCATTGTGAAACAAAGTGTTGG - Intergenic
1092146578 12:6218819-6218841 TTCATTGTGGGCCTGAGTTTGGG + Intronic
1095592955 12:43925253-43925275 CTCATTGAGGGCCATCTTGTAGG + Intronic
1098200851 12:68054080-68054102 CTCATAATTGGCCAAAGTCTTGG - Intergenic
1098609970 12:72444613-72444635 CTAATTGTGGGCCTAATTGAAGG + Intronic
1101445374 12:104733511-104733533 CACAGTGTGTGTCAAAGTGTTGG - Intronic
1107340915 13:39404596-39404618 TTCATTGTGCACCAAAGTTTGGG + Intronic
1108568744 13:51728837-51728859 CCCAGTCTTGGCCAAAGTGTAGG - Intronic
1110971694 13:81770922-81770944 ATTTTAGTGGGCCAAAGTGTTGG + Intergenic
1117011886 14:51479237-51479259 ATCATTGTGCGCTAAAGGGTTGG + Intergenic
1118636162 14:67750614-67750636 GACATTGTTGGTCAAAGTGTGGG + Intronic
1121895763 14:97645708-97645730 CTCATTGTGGGCCACATCATGGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1132571804 16:647500-647522 CTCCTCGTGGGCCACTGTGTAGG - Exonic
1143103790 17:4518572-4518594 TTCATTCTGGGACCAAGTGTGGG + Intronic
1143165443 17:4895156-4895178 CTCACTGTGGGCCCGGGTGTTGG - Exonic
1143224261 17:5287254-5287276 ATCACTCTGGGCCAAAGTGCTGG + Intronic
1143835045 17:9684883-9684905 CTCATTCTGGGCCAGAGTCCGGG + Intronic
1148026916 17:44594954-44594976 CTCAGTGTGTGCAAAAGTGTGGG - Intergenic
1148318489 17:46726418-46726440 TTTATTGTAGTCCAAAGTGTTGG + Intronic
1148674068 17:49434923-49434945 CTCCTTGAGGGCCAGAGTGCTGG - Intronic
1151425260 17:74026964-74026986 CTGAGAGTGGGCCAAAGTGCAGG + Intergenic
1152475692 17:80516680-80516702 CTCATTGGGGGACAGAGTGAGGG - Intergenic
1156208594 18:34913193-34913215 CTTATTGTGGGTCCAAGTGATGG - Intergenic
1157934614 18:51859240-51859262 CTCAGTGTGATCCCAAGTGTGGG + Intergenic
1166272230 19:41721580-41721602 CTCATTTGGGGAAAAAGTGTGGG - Intronic
1167350003 19:48968640-48968662 CTCTTGCTTGGCCAAAGTGTAGG + Exonic
925836077 2:7948294-7948316 CACATTTTTGGCCAAAGTGATGG + Intergenic
927201371 2:20580063-20580085 CTGGGTGTGGGCCAAATTGTGGG - Intronic
927416942 2:22889864-22889886 CTCATTGTGAGCAGAAGTGTGGG + Intergenic
928792147 2:34970731-34970753 ATTACTGTGTGCCAAAGTGTGGG + Intergenic
931982973 2:67713961-67713983 CTCATAGTTGGAGAAAGTGTTGG - Intergenic
933153027 2:78937527-78937549 CTCTCTGTGGGCCAAAGTTATGG + Intergenic
935140456 2:100348714-100348736 CTCATTGTGGACCATGGAGTAGG - Intergenic
937368675 2:121283388-121283410 CTCAGTGAGGGCCAAGGTGGCGG - Intronic
938985261 2:136569336-136569358 CACTTTGTGGTCCAAAGGGTAGG - Intergenic
942236722 2:173916658-173916680 TTCATTGTTGGCAAAGGTGTGGG + Intronic
942324249 2:174762024-174762046 CTCTTAGTGGGCCATAGGGTTGG - Intronic
942920704 2:181370167-181370189 CTGATCGTGGGCCCAAATGTGGG + Intergenic
944708587 2:202315362-202315384 CCCAGTGTTGGCCAGAGTGTAGG + Intergenic
944855462 2:203762865-203762887 CTAATTGCTGGCAAAAGTGTGGG - Intergenic
946401357 2:219470066-219470088 ATCATCGTGGGTCAAAGAGTGGG - Intronic
946624722 2:221598751-221598773 TAAATTGTGGACCAAAGTGTGGG - Intergenic
1171224787 20:23433312-23433334 CTCAGAGTGGGCAAAAATGTGGG + Intergenic
1172906271 20:38372139-38372161 ATCAGTGTGGGCCAAAGTTATGG + Intronic
1174351908 20:49974492-49974514 CTCGTTGTGGGCCATAGTGAAGG + Intergenic
1176301002 21:5099091-5099113 ATCTGTGTGGGCCAGAGTGTTGG + Intergenic
1184282321 22:43444856-43444878 CTCATTTTGTGTCAAAGAGTTGG + Intronic
1184629915 22:45769002-45769024 CTCTTGGTGGGAAAAAGTGTGGG + Intronic
949648981 3:6132876-6132898 CTCAATGTGTACCAAAGTGATGG - Intergenic
953617290 3:44502754-44502776 CTCTTCGTGGGCAAAAGTATGGG + Intronic
955716803 3:61837977-61837999 TTAAATGTGGGCAAAAGTGTCGG - Intronic
962941008 3:140124873-140124895 CTCACTGTTGGCCAAAGACTTGG - Intronic
963024769 3:140908778-140908800 CACATTGTGGGGCAGAATGTTGG - Intergenic
963364399 3:144316419-144316441 GCCATTCTGGGCCAAAGTGGAGG + Intergenic
969458216 4:7313177-7313199 TTCATTGTGCACCAACGTGTAGG + Intronic
976384320 4:84437893-84437915 CTCACTATGGGGAAAAGTGTGGG - Intergenic
980753507 4:137124984-137125006 CTGATGGTGTGCCAAAGTTTTGG - Intergenic
983507862 4:168574720-168574742 CTCATTCAGGGCAAAAGAGTTGG - Intronic
987393857 5:17402517-17402539 AGCATCGTGGGCCAAAATGTGGG + Intergenic
988735585 5:34017451-34017473 CCCAAAGTGGGCCAAAGTTTAGG - Intronic
990519896 5:56569085-56569107 CTCATTGTTGGCGAGGGTGTAGG + Intronic
996339951 5:122425590-122425612 TTCCTTGTGAGCTAAAGTGTTGG + Intronic
1001431356 5:171665107-171665129 CTCATTGTATGCCAAAGAGCAGG - Intergenic
1001726411 5:173905680-173905702 CTTTTTGTGGGCAAAAGTGATGG + Intronic
1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG + Intronic
1003912470 6:10754866-10754888 CACATTGATGGCTAAAGTGTGGG + Intronic
1007259920 6:40556225-40556247 CCCAGTCTGGGCCAAGGTGTAGG - Intronic
1008430261 6:51408388-51408410 CTGATTGTGGGGCAGAGGGTAGG - Intergenic
1010749626 6:79603679-79603701 ATCATTGTGGGCCACAATGGTGG - Intergenic
1012975910 6:105780889-105780911 CTCCCTGTGGGCCGAAGTGATGG + Intergenic
1014226073 6:118848553-118848575 GACTTTGTGGGCCAAACTGTTGG - Intronic
1016624028 6:146145181-146145203 CTCTTTATGTGCCAAAGTGAGGG - Intronic
1018019770 6:159750041-159750063 CTGATTGTGGGGCAGAGGGTGGG + Intronic
1019638234 7:2088367-2088389 CTCAGTGTGGGCCAGAAGGTTGG - Intronic
1024777009 7:52799454-52799476 CTCATTTTGGGCCAAAGCCTAGG - Intergenic
1033096181 7:138433490-138433512 CTCATTGTGAGCCACTGTGCCGG - Intergenic
1036983698 8:13501371-13501393 TTCATTGTGGGGCAAAATTTGGG - Intronic
1039496528 8:37984965-37984987 CTCATTGTAGGCCAATGTGGGGG + Intergenic
1043935319 8:86136060-86136082 CTCATTGTGGGCCAAGCCCTGGG + Intronic
1044428361 8:92080451-92080473 CTCAGTGTGGGACAAAGGGCTGG - Intronic
1046285982 8:112092920-112092942 CTCATTGTGGGCTTGAGTGGTGG + Intergenic
1046978702 8:120312778-120312800 GGCATTGTGGGGTAAAGTGTGGG - Intronic
1050694181 9:8260849-8260871 CTCATTATGGGCCAATGGCTTGG - Intergenic
1050822157 9:9892597-9892619 AACATTTTGGGCCAAACTGTTGG + Intronic
1052341158 9:27365712-27365734 CTCAATGTGGGCCAACTTCTTGG - Intronic
1053519259 9:38761626-38761648 CTGATTGTGGACCAGAGTGTGGG - Intergenic
1057941763 9:99291334-99291356 CTCATTCTGGGCCACAGTTTTGG + Intergenic
1058752797 9:108055352-108055374 GTCTTTGTGGGCAAATGTGTAGG - Intergenic
1060381778 9:123181964-123181986 CTCCTCGTGAGCCAAAGTGTTGG - Intronic
1187876646 X:23809527-23809549 CTCATTGTGTGACAAAATATTGG + Intergenic
1192911343 X:75607926-75607948 TTGACTGTGGGCCAATGTGTGGG - Intergenic
1195392189 X:104374154-104374176 CCCATTCTTGGCCAAAGTGCTGG + Intergenic
1197941606 X:131795842-131795864 CTCCTTGTGGGCCAGTGTGTAGG + Intergenic
1200217949 X:154376809-154376831 CTGATTGTGGGGCAAAGGGGTGG + Intergenic