ID: 906700183

View in Genome Browser
Species Human (GRCh38)
Location 1:47852134-47852156
Sequence AGCCACCGCCATGGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906700173_906700183 -4 Left 906700173 1:47852115-47852137 CCAAACCCAAACACCCACCAGCC 0: 1
1: 0
2: 4
3: 69
4: 389
Right 906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 305
906700175_906700183 -10 Left 906700175 1:47852121-47852143 CCAAACACCCACCAGCCACCGCC 0: 1
1: 0
2: 1
3: 57
4: 415
Right 906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 305
906700171_906700183 -2 Left 906700171 1:47852113-47852135 CCCCAAACCCAAACACCCACCAG 0: 1
1: 0
2: 4
3: 45
4: 501
Right 906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 305
906700172_906700183 -3 Left 906700172 1:47852114-47852136 CCCAAACCCAAACACCCACCAGC 0: 1
1: 0
2: 4
3: 73
4: 440
Right 906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 305
906700170_906700183 9 Left 906700170 1:47852102-47852124 CCAAAGAATAACCCCAAACCCAA 0: 1
1: 0
2: 3
3: 37
4: 317
Right 906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 305
906700174_906700183 -9 Left 906700174 1:47852120-47852142 CCCAAACACCCACCAGCCACCGC 0: 1
1: 0
2: 1
3: 16
4: 224
Right 906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906700183 Original CRISPR AGCCACCGCCATGGGCCCTG GGG Intronic
900296573 1:1954850-1954872 AGCCCCAGCCAGGTGCCCTGTGG + Intronic
902410253 1:16207916-16207938 AGCTCCTCCCATGGGCCCTGAGG - Intronic
903034949 1:20486952-20486974 AGCAACAGCCGTGCGCCCTGTGG + Intergenic
903232121 1:21928205-21928227 AGCCACTTCCCTGGGCACTGTGG - Intronic
903344926 1:22677832-22677854 AGCCCCCAGCATGGGCCCTCAGG + Intergenic
904029517 1:27525642-27525664 AGCCGGCCCCTTGGGCCCTGCGG + Intergenic
904335404 1:29794061-29794083 AGTGACCGGCATGGGGCCTGGGG + Intergenic
905671056 1:39789966-39789988 AGCCTCCGCCATTTGCCCCGTGG - Intergenic
905918226 1:41700525-41700547 AGCCAAGGCCCTGGGCTCTGGGG - Intronic
906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG + Intronic
907267972 1:53274342-53274364 AGCCAAGGCCCTGGGCTCTGAGG - Intronic
907302725 1:53498657-53498679 AGCCATCTCCACGGGGCCTGGGG - Intergenic
907927309 1:58966572-58966594 CCCCACCCCCATGGCCCCTGAGG - Intergenic
908156716 1:61360837-61360859 AGACACCGCCAATGGGCCTGAGG - Intronic
909501989 1:76345013-76345035 AGCCACAGCCAAGGAACCTGAGG - Intronic
912471348 1:109909291-109909313 AGGCACCGTGCTGGGCCCTGGGG - Intergenic
912473745 1:109923254-109923276 CGCCCCCTCCATGGCCCCTGTGG + Exonic
913517637 1:119617975-119617997 AGTCACAGCCTTGGGGCCTGGGG + Intergenic
913712004 1:121494444-121494466 AGTGAGCGCCATGGGCTCTGTGG - Intergenic
916060986 1:161098525-161098547 GGCCACCGCCATGGGCCCCGGGG - Exonic
917845465 1:179016420-179016442 AGCCACAGTGCTGGGCCCTGAGG - Intergenic
919776706 1:201199047-201199069 TGCCACCTCCCTGGCCCCTGCGG + Intronic
919856824 1:201711797-201711819 AGGCACCACCCTGGGCCCTAAGG - Intronic
919974334 1:202600876-202600898 GTCCACCACCAAGGGCCCTGGGG + Intronic
922467393 1:225853599-225853621 AGGCACAGCCCTGGGCCCAGGGG + Intronic
922712813 1:227845866-227845888 AGCCACCCCCTTGCACCCTGGGG + Intronic
922780648 1:228249959-228249981 AAACACCGCCTTGGGCTCTGGGG - Exonic
922781917 1:228259495-228259517 AAACACCGCCTTGGGCTCTGGGG - Exonic
922782488 1:228264110-228264132 AAACACCGCCTTGGGCTCTGGGG - Exonic
922783506 1:228271919-228271941 AAACACCGCCTTGGGCTCTGGGG - Exonic
923784943 1:237057468-237057490 AGCCACCGCGCCTGGCCCTGAGG + Intronic
1062821717 10:539535-539557 ACCCACCCCCATGGGCACTGTGG + Intronic
1063922414 10:10945708-10945730 AGTCACTGGCATGAGCCCTGTGG + Intergenic
1064337555 10:14457597-14457619 AGCCACAGGCCTGGGCTCTGGGG + Intronic
1064485348 10:15782968-15782990 AGACTCAGCCAGGGGCCCTGAGG - Intronic
1064613985 10:17133963-17133985 AGCCACCGCGCCGGGCCCTAAGG - Intergenic
1066654249 10:37684174-37684196 GGCCACAGCCATGGCCACTGAGG + Intergenic
1067170037 10:43898737-43898759 GGCCACCCCCATGACCCCTGGGG - Intergenic
1070809864 10:79292287-79292309 AGCCACAGCCACGGCCACTGTGG + Exonic
1071210487 10:83336553-83336575 AGCCACCGCAACTGGCCCTTAGG - Intergenic
1071335190 10:84594629-84594651 AGCCACCGCCCTCGGCCATGTGG + Intergenic
1072211986 10:93254452-93254474 GGCCACCGGCAGGGGCCCTATGG + Intergenic
1074152955 10:110774534-110774556 AGCTACCTCCATCAGCCCTGAGG + Intronic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1074406011 10:113180908-113180930 AGCCAAAGCCCTGGGCACTGTGG - Intergenic
1076701756 10:132276886-132276908 AGCCACGGCCTCGAGCCCTGGGG - Intronic
1076770256 10:132659042-132659064 GGCTACCGACCTGGGCCCTGGGG + Intronic
1077036935 11:499790-499812 AGCGGCCAGCATGGGCCCTGGGG + Intronic
1077578873 11:3404427-3404449 AGCCCACGCCATGTGCTCTGGGG + Intergenic
1078631608 11:13009232-13009254 AGCCACAGCTCTGGGCCTTGGGG + Intergenic
1081563022 11:44236486-44236508 AGTCACCTCCATGTGCACTGTGG + Intronic
1083594484 11:63912353-63912375 AGCCTCCTCCATGGGGACTGGGG + Exonic
1084426918 11:69089112-69089134 AGCCCACGCCATAGCCCCTGTGG + Intronic
1084541935 11:69792420-69792442 AGGGACCACCATGGGTCCTGGGG - Intergenic
1084720537 11:70902822-70902844 ACACCCCGCCAGGGGCCCTGGGG + Intronic
1084802568 11:71554822-71554844 ACCCACTGCCATGGACTCTGAGG - Intronic
1084868732 11:72081135-72081157 AGCCACCGCTCCCGGCCCTGGGG - Intronic
1084919702 11:72459121-72459143 AGCCACTGCCATAGGAGCTGTGG + Intergenic
1085122637 11:73976959-73976981 AGCCACAGCCAGGGCACCTGTGG + Exonic
1085126484 11:74005875-74005897 GGTCACCGCCATGGCTCCTGTGG + Exonic
1085181787 11:74542606-74542628 AGACAAGGCCATGGGGCCTGAGG + Intronic
1085277790 11:75311049-75311071 AGCCACCGCGCCTGGCCCTGTGG - Intronic
1088410196 11:109525796-109525818 AGCCACCGCGCCCGGCCCTGTGG - Intergenic
1090329797 11:125922246-125922268 AGCCACATCCATGGGCTTTGGGG - Intronic
1090785199 11:130042497-130042519 AGCCACCGTGATAAGCCCTGAGG - Intergenic
1091340666 11:134810408-134810430 AGCCACAGCCATGAAGCCTGGGG - Intergenic
1091393335 12:138980-139002 AGCCCCCGCCGTGGGCCGGGAGG + Exonic
1091446719 12:547972-547994 CGCCATCTCCATGGGCCCTGGGG - Intronic
1093084408 12:14851079-14851101 AGCAAAAGCCATGTGCCCTGGGG + Intronic
1093093132 12:14943151-14943173 AGCCACCGCACCTGGCCCTGAGG + Intronic
1094250238 12:28351515-28351537 AGCCAGGGCCATGGGCACAGAGG - Intronic
1094830515 12:34298053-34298075 AGCCCCTGCACTGGGCCCTGGGG + Intergenic
1094831937 12:34304291-34304313 AGCCCCTGCGGTGGGCCCTGGGG + Intergenic
1094837340 12:34328308-34328330 AGCCACTGCATGGGGCCCTGGGG - Intergenic
1095953112 12:47792042-47792064 AGCCAAGGCCATGGGGCGTGAGG - Intronic
1096154499 12:49334456-49334478 AGCGACCGCCATGAGCCCGGAGG - Intronic
1096547642 12:52351820-52351842 AGGCACCACCACGGGCACTGTGG + Intergenic
1096693989 12:53337392-53337414 AACCTGGGCCATGGGCCCTGAGG + Intronic
1100053813 12:90484770-90484792 AGCCACCGCACTGGGCCCCAAGG - Intergenic
1100934708 12:99649520-99649542 AGCCACATCCATGGTACCTGTGG - Exonic
1101510027 12:105384640-105384662 AGACATTGCCATGGGCCATGTGG + Intronic
1102775749 12:115517337-115517359 AGCCACCAGCATGGACCCTAAGG + Intergenic
1103553501 12:121752012-121752034 AGCCACTGCCATGGCCCATAAGG - Intronic
1103722970 12:122984325-122984347 AGCCCCTGTCAGGGGCCCTGTGG - Exonic
1104545135 12:129704316-129704338 AGCAAAGGCCATGGGCCATGTGG + Intronic
1106254748 13:28012077-28012099 ACCCACTGCAATGGGCCATGGGG + Intronic
1107822203 13:44296136-44296158 AGCCACCTCCCTGGGTCCTGAGG + Intergenic
1108462863 13:50684585-50684607 AGCCACCGCAATGGGCCGGGAGG + Intronic
1116819348 14:49612912-49612934 AGCCACTGCGCTGGGCCTTGAGG - Intronic
1118444861 14:65841507-65841529 ACCCTCCGCCATCGGCCCCGTGG - Intergenic
1119899712 14:78249350-78249372 AGCCCCCGGCATCGGTCCTGTGG - Intronic
1121007779 14:90501209-90501231 AGCAGCCGCCAAGGCCCCTGGGG - Intergenic
1121045498 14:90784780-90784802 AGCCACCCCCTAGGGGCCTGGGG + Intronic
1122151364 14:99727809-99727831 AGCCACCGCACCGGGCCATGAGG - Intergenic
1122497491 14:102169207-102169229 AGCCAGCGCCATGGCCACTGGGG - Intronic
1122889334 14:104725161-104725183 AGGCCCAGCCCTGGGCCCTGGGG - Intronic
1202898526 14_GL000194v1_random:23224-23246 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1202904229 14_GL000194v1_random:59348-59370 AGCCACAGCCCTCTGCCCTGAGG - Intergenic
1128304851 15:66591614-66591636 AGCCACAGTTCTGGGCCCTGGGG + Intronic
1128939236 15:71774025-71774047 AGCCACCGCACCCGGCCCTGTGG - Intronic
1128983461 15:72202509-72202531 AGCCACCGCCGTGGGTGCCGTGG - Intronic
1129234214 15:74214112-74214134 ACACACCCCCATGGCCCCTGAGG - Intergenic
1129360782 15:75022658-75022680 AGCCACCACGCTCGGCCCTGGGG - Intergenic
1129871446 15:78944336-78944358 ACCTGACGCCATGGGCCCTGGGG + Intronic
1130151416 15:81314597-81314619 AGCCACCGTGCTTGGCCCTGGGG - Intronic
1130557879 15:84935572-84935594 AGCAGCTGCCAGGGGCCCTGAGG - Intronic
1130758269 15:86789632-86789654 AGCCACTGAAATGGGCACTGTGG - Intronic
1131762391 15:95638498-95638520 AGCCACCGCGCCCGGCCCTGAGG + Intergenic
1132404715 15:101535421-101535443 TGCCACCACCCTGGGCCCTGTGG - Intergenic
1134234402 16:12454205-12454227 AGCAGCCGCCTTGGGCCATGTGG + Intronic
1136028075 16:27482680-27482702 AGCCACCGCCTTGGCCCCTCTGG + Intronic
1136453853 16:30369830-30369852 AGCCACTGCCGCGGGCTCTGGGG + Exonic
1136639517 16:31550969-31550991 AGCCGACGCCAGGGACCCTGGGG + Intergenic
1136665244 16:31805559-31805581 AGCCGACGCCAGGGACCCTGGGG - Intergenic
1136719492 16:32309207-32309229 AGCCACCGCAATCGGCCTAGTGG + Intergenic
1136837866 16:33515487-33515509 AGCCACCGCAATCGGCCTAGTGG + Intergenic
1137716539 16:50601731-50601753 AGCCACCACCAGGTGACCTGTGG + Intronic
1138204542 16:55115177-55115199 TGCAACCCCCATGGGCTCTGGGG + Intergenic
1140640110 16:76961574-76961596 AGCCAACCCCATGGGCACTATGG - Intergenic
1141744705 16:85918028-85918050 AGGCACTGCCAAGGGCACTGCGG - Intronic
1141748953 16:85945584-85945606 AGCCATCTCCATGGGCCCCGCGG - Intergenic
1142088377 16:88196854-88196876 ACACACCTCCATGAGCCCTGTGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1203006939 16_KI270728v1_random:208562-208584 AGCCACCGCAATCGGCCTAGTGG - Intergenic
1203148048 16_KI270728v1_random:1815771-1815793 AGCCACCGCAATCGGCCTAGTGG + Intergenic
1143020534 17:3915159-3915181 AGCCCCCTCCAGTGGCCCTGGGG + Intronic
1144434957 17:15231887-15231909 AGCCTCCATCTTGGGCCCTGTGG + Intronic
1144726296 17:17504272-17504294 TGCCTCCACCATGTGCCCTGGGG + Intergenic
1146256267 17:31392789-31392811 TGCCACCGGCATGGGGACTGGGG + Intronic
1147735016 17:42631133-42631155 AGCCACCACGCTGGGCCATGTGG - Intergenic
1148127895 17:45246208-45246230 AGTCACCGCCAAAGGCCCGGCGG + Exonic
1150795783 17:68235594-68235616 AGGCACCGAGAGGGGCCCTGAGG - Intergenic
1152383764 17:79956537-79956559 AGCCACCACGCTGGGCCCGGTGG + Intronic
1152815905 17:82407652-82407674 CGCCACAGCCACTGGCCCTGCGG + Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1152860779 17:82696151-82696173 AGCCACCGCCCCCGGCCCGGTGG + Intronic
1153178876 18:2409983-2410005 AGCCACCGCGCCCGGCCCTGAGG + Intergenic
1154221781 18:12461141-12461163 AGACACAGTCATGGGCCCTTGGG + Intronic
1154390358 18:13931535-13931557 AGCCACCAGCAGGGGTCCTGGGG + Intergenic
1157203775 18:45681347-45681369 AGCCACCGCGCCCGGCCCTGAGG + Intronic
1157404243 18:47410137-47410159 AGCCACCGCGCCCGGCCCTGTGG + Intergenic
1160510576 18:79451310-79451332 AGCCAGCGCCAGGGGCCCCCGGG - Intronic
1160682310 19:417455-417477 AGCCCCAGCCATGCGACCTGAGG - Intronic
1160758505 19:771052-771074 AGCCACCGCGCCCGGCCCTGCGG - Intergenic
1160871297 19:1279053-1279075 AGCCACCGCCCAGGACGCTGAGG + Exonic
1161488845 19:4550728-4550750 AGCCCCAGCCCTCGGCCCTGGGG + Intronic
1161946968 19:7443484-7443506 AGCCACCACCCTTGGCCCTCAGG + Intronic
1162619994 19:11835078-11835100 AGCCACCGCACTCGGCCCTAAGG - Exonic
1163445966 19:17346692-17346714 AGCCACCGCGCCCGGCCCTGAGG - Intergenic
1163633681 19:18429072-18429094 GGCCTCCGCCCTGGGCCCTGCGG - Intronic
1165278174 19:34772830-34772852 CGGCGCCGCCATGGGCCCAGGGG + Exonic
1165383086 19:35494794-35494816 AGCCACCGCACTCGGCCCTCAGG - Intronic
1166173750 19:41050739-41050761 AGTCACAGTCATGAGCCCTGAGG - Intergenic
1166537126 19:43581279-43581301 ATCCACCACCATGGGCCCCAAGG + Exonic
1166640711 19:44492929-44492951 GGCCTCCCACATGGGCCCTGTGG - Intronic
1167312945 19:48747575-48747597 AGCCACCGCGCCGGGCCCTGAGG - Intergenic
1168136466 19:54355493-54355515 GGCCATCTCCATGGGCCCTGAGG + Intronic
1168567660 19:57438592-57438614 TGCCACTGCAATGGACCCTGTGG - Intronic
1168571880 19:57477298-57477320 AGCCGCCGCCATCAGGCCTGTGG + Exonic
925615202 2:5738793-5738815 AGCCACCGCGCCGAGCCCTGTGG + Intergenic
927144446 2:20153330-20153352 AGGCATTGCCATAGGCCCTGGGG + Intergenic
927519251 2:23689254-23689276 AGCCACAGCCATGCCTCCTGTGG + Intronic
927810773 2:26179195-26179217 AGCCCCCGCCCCTGGCCCTGCGG + Intronic
928104018 2:28455994-28456016 AGCCACTGCTTTGGGCACTGGGG + Intergenic
928171923 2:29009783-29009805 ACCCACCTCCTTGGGGCCTGCGG + Intronic
928393825 2:30929264-30929286 AGCCACAGCCTTGGGCCCTGCGG + Intronic
929157000 2:38797308-38797330 AGCCACCGCGTCCGGCCCTGAGG + Intergenic
931603349 2:64026627-64026649 AGCCACAGTCAGGGGCCCTGCGG - Intergenic
932084576 2:68746719-68746741 AGCCACCGCGCCCGGCCCTGTGG - Intronic
932777488 2:74536801-74536823 TGACACCGCCAGGTGCCCTGGGG - Exonic
934502410 2:94871049-94871071 AGCCACAGCCCTCTGCCCTGAGG + Intergenic
934619837 2:95797326-95797348 AGCCATGGCCCTAGGCCCTGTGG - Intergenic
934641051 2:96027231-96027253 AGCCATGGCCCTAGGCCCTGTGG + Intronic
936233506 2:110724675-110724697 ACACACCTCCAGGGGCCCTGAGG - Intergenic
937248666 2:120510168-120510190 GGCCACCTCCATGGGGGCTGTGG + Intergenic
937855335 2:126668319-126668341 AGCCATCACAAGGGGCCCTGGGG - Intronic
938057903 2:128230875-128230897 AGCCACCGCGCTTGGCCCAGGGG + Intergenic
938489551 2:131754604-131754626 AGCCCCTGCGCTGGGCCCTGGGG + Intronic
938900850 2:135797437-135797459 AGCCCCCAGCATGCGCCCTGGGG + Intronic
940447489 2:153793255-153793277 AGCCACCGCACCCGGCCCTGAGG + Intergenic
942663659 2:178292692-178292714 AGGCACTGTTATGGGCCCTGGGG + Intronic
946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG + Exonic
946767429 2:223053347-223053369 AGCCACCGGCAGGGGTCCCGGGG - Exonic
947739504 2:232478698-232478720 CGGCACCTCCATGGGGCCTGGGG + Intergenic
947800029 2:232923448-232923470 AGCCACTGCACTGGGCCTTGTGG - Intronic
948798544 2:240419594-240419616 AGCCTCAGCCATCGGCCCTCAGG + Intergenic
949045472 2:241870794-241870816 AGCCAAAGCCACGGGCGCTGGGG - Intronic
1169224515 20:3847615-3847637 AGCCAGCGACCTGGGACCTGTGG + Intronic
1171178873 20:23076933-23076955 AGCCACAGCCATGGGGGATGAGG + Intergenic
1171377534 20:24703507-24703529 AGCCACCGCCACTGCCCATGTGG - Intergenic
1171507844 20:25653425-25653447 AGCCACCGCCAGGGCCTCTCAGG + Intergenic
1171777346 20:29381263-29381285 GCCCACCATCATGGGCCCTGAGG - Intergenic
1172275372 20:33676294-33676316 AGGCACTGCCCTGGGCCTTGTGG + Exonic
1172511673 20:35505070-35505092 GCCCACCACCCTGGGCCCTGTGG + Intronic
1172898461 20:38316850-38316872 AGGCATCCCCATGGCCCCTGTGG - Intronic
1173513021 20:43645266-43645288 AGCCACCGCACTGGGCCCCAAGG - Intronic
1174382154 20:50162898-50162920 AGCAACCTTCTTGGGCCCTGAGG - Intergenic
1174776296 20:53345900-53345922 TGCCAGCGCCATGGCCCCAGGGG - Intronic
1176114304 20:63424392-63424414 AGCTGCCTCCGTGGGCCCTGGGG - Intronic
1176618208 21:9039214-9039236 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1176706633 21:10123244-10123266 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1179593626 21:42427779-42427801 AGGCACCAGGATGGGCCCTGGGG - Intronic
1179955248 21:44734845-44734867 AGCAATAGCCATGTGCCCTGTGG + Intergenic
1180354084 22:11824581-11824603 AGCCCCTTCCCTGGGCCCTGGGG - Intergenic
1180384161 22:12167744-12167766 AGCCCCTTCCCTGGGCCCTGGGG + Intergenic
1180906856 22:19419665-19419687 AGCCACAGCTCTGGGTCCTGAGG - Intronic
1180974705 22:19841971-19841993 AGCCAAGGCCATGAGGCCTGAGG + Intronic
1181003005 22:19996784-19996806 GGGCACCGCCCTGGCCCCTGGGG - Intronic
1181318317 22:21985450-21985472 AGACACCGCCATGGGACTTCAGG + Intergenic
1182063274 22:27412985-27413007 AGCCCCTACCATGGGCCATGGGG + Intergenic
1182566346 22:31202897-31202919 AGCCACCGCGCCCGGCCCTGGGG + Intronic
1182923661 22:34103010-34103032 AGCCACCGCGCCCGGCCCTGAGG - Intergenic
1183810726 22:40254982-40255004 AGCAACCTCCATGGACCTTGTGG + Intronic
1184234026 22:43173671-43173693 AGCCAGGGCCCTGAGCCCTGGGG + Intronic
1184482357 22:44755271-44755293 AGCCACCTCCCTGGGCACTGAGG + Intronic
950143022 3:10628173-10628195 AGCCCTGGCCATGGGCCCTGAGG - Intronic
950184962 3:10939292-10939314 AGCCCCTGCCATGGGGGCTGAGG - Exonic
950215023 3:11153340-11153362 TGTTACCGACATGGGCCCTGAGG + Intronic
950912122 3:16605434-16605456 AGCCACCTCCCTGAGCCCCGCGG - Intronic
953377865 3:42444031-42444053 AGCCCCAGCCATGGGCCATGTGG - Intergenic
953454410 3:43030448-43030470 AGCCACCGCCTGGGGCTCTTCGG - Intronic
953751199 3:45609851-45609873 AGGCAGTGCCTTGGGCCCTGGGG - Intronic
955208842 3:56922114-56922136 AGCCACCGGCCTGGCCGCTGCGG + Intronic
956463913 3:69500114-69500136 AGCCACAGCTCTGGGTCCTGGGG - Intronic
956979053 3:74614877-74614899 CGCCGCCGCCCAGGGCCCTGCGG - Intergenic
961037524 3:123652943-123652965 AGGCACTGCCATGGGCACTGGGG - Intronic
961449420 3:126995768-126995790 AGCCACCCACCTGGGCTCTGAGG + Intronic
961454334 3:127016751-127016773 GGCCACCGCCAAGTGCCCAGTGG - Intronic
961458606 3:127036436-127036458 AGACACAGCCATGTGCTCTGTGG - Exonic
962696722 3:137955841-137955863 ACCCAACGACATGGGCTCTGAGG + Intergenic
963554655 3:146772452-146772474 GGCCACCGCCCTGGGCAGTGAGG + Intergenic
966938208 3:184728176-184728198 AGCCACCGCGCCCGGCCCTGTGG + Intergenic
968429104 4:544823-544845 CACCACCACCACGGGCCCTGGGG + Intergenic
968490335 4:886751-886773 AGCCACAGCCCTGGGCCCAGTGG + Intronic
968793901 4:2688960-2688982 AAGCCCCGCCCTGGGCCCTGTGG - Intronic
969255690 4:6000253-6000275 AGCCACAGCCATGGCCACTGAGG + Intergenic
969379184 4:6783003-6783025 GGCCGCCGCCGTGGGCTCTGGGG + Intronic
969477533 4:7429991-7430013 GGCCACTGTCCTGGGCCCTGTGG + Intronic
969604752 4:8196834-8196856 AGCCCCCTCCTTGGGCCTTGGGG - Intronic
969606102 4:8202993-8203015 AGCCACAGCCATGGGGGCAGGGG + Intronic
969724186 4:8909511-8909533 AGCCACCGCTCTGGGCCCAGGGG + Intergenic
973816272 4:54622358-54622380 AGCCAAAGTCCTGGGCCCTGTGG - Intergenic
974013373 4:56627121-56627143 GGCCACCCACCTGGGCCCTGGGG - Intergenic
976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG + Intronic
976597271 4:86906004-86906026 AGCCACCGCTCCTGGCCCTGAGG + Intronic
976783866 4:88793864-88793886 ATCCACCGCCATAGTTCCTGTGG + Intronic
976854167 4:89583062-89583084 GGCCACTGCCTAGGGCCCTGGGG + Intergenic
977452071 4:97211854-97211876 AGCCAGGGCCATTGACCCTGTGG + Intronic
980463704 4:133149069-133149091 AGCCAGCGCCTCGGGACCTGCGG + Intergenic
982468565 4:155759690-155759712 AGCCAGCGCCATGGGAGCAGAGG + Intronic
984704346 4:182836847-182836869 AGCCACAGCCCTGGCCCCTCAGG + Intergenic
986873836 5:12081732-12081754 ACCCACTGCCTAGGGCCCTGGGG + Intergenic
992561743 5:77958884-77958906 AGCCACCCCCAGAGGCCCGGAGG + Intergenic
995071760 5:107930605-107930627 AGGCACTGGCATGGGCACTGGGG - Intronic
995191566 5:109323553-109323575 AGCCAGAGCCATGGGCCAGGAGG - Intergenic
995595308 5:113741699-113741721 AGCCACCGCGCTGGGCCCAATGG + Intergenic
997586900 5:135048715-135048737 CGCCCCCTCCATGGGCCCTCAGG + Intronic
997609712 5:135207070-135207092 AGCCACCTCCTGGGGCCCAGAGG + Intronic
1000226012 5:159262859-159262881 AGACCCCTCCATGGGCCCAGGGG - Intergenic
1000903554 5:166936468-166936490 CCCCACCGCCATGGGCAGTGAGG - Intergenic
1001100980 5:168814108-168814130 AGCCACCGCACCCGGCCCTGTGG - Intronic
1001695222 5:173664809-173664831 GGCCACTGCCGTGGGCCTTGGGG + Intergenic
1002932470 6:1644034-1644056 AGTCACAGCGCTGGGCCCTGGGG - Intronic
1003422802 6:5973647-5973669 AGCTACTGCCATGGGCACTGTGG + Intergenic
1003592156 6:7445524-7445546 AGCCAAGGCCATGGGAGCTGGGG + Intergenic
1003859201 6:10306765-10306787 AGCCACCGCACCCGGCCCTGGGG - Intergenic
1004397068 6:15254752-15254774 AGCCACCGCGCCCGGCCCTGTGG - Intronic
1005615185 6:27566146-27566168 GGCGACCGCCATGGGGCCAGGGG + Intergenic
1006348462 6:33502791-33502813 GGCCAGCGCCACTGGCCCTGGGG + Intergenic
1006910431 6:37560015-37560037 TGTCACCCCCAAGGGCCCTGAGG + Intergenic
1007798677 6:44372743-44372765 AGCCACCGCAACAGGCCTTGTGG + Intronic
1014863834 6:126504459-126504481 AGCCACCGCGCCCGGCCCTGGGG + Intergenic
1016569058 6:145492372-145492394 TGCCACCCCCAAGGCCCCTGAGG + Intergenic
1017543569 6:155427594-155427616 AGCCACTGTCATGAGCACTGTGG - Intronic
1017882643 6:158572484-158572506 GGCCCCCGCCCTGTGCCCTGAGG - Intronic
1017888998 6:158624209-158624231 AGCAACAGACGTGGGCCCTGGGG - Intronic
1018616121 6:165688510-165688532 AGCAATCTCCATGGGCCCAGTGG + Intronic
1019136029 6:169908124-169908146 GGCCATCGCCAGGGGCCCTGGGG + Intergenic
1019681167 7:2350516-2350538 AGCCACCGCGCTCGGCCCAGGGG - Intronic
1020007916 7:4792157-4792179 CGCCACCTTCCTGGGCCCTGTGG + Intronic
1021225534 7:18021692-18021714 AGCTGCCGCCATAGGCCCAGAGG - Intergenic
1022207515 7:28179544-28179566 ATGCCCGGCCATGGGCCCTGGGG + Intronic
1024477703 7:49831198-49831220 AGCCACCACCATAAGCCCTTAGG - Intronic
1024957089 7:54933466-54933488 AGCCACAGCCAGGGCCGCTGTGG + Intergenic
1026808555 7:73443408-73443430 TGCCACAGCCTTGGGCTCTGTGG - Intronic
1026963736 7:74426120-74426142 AGCCAGGGCCATGGTCCCTGAGG - Intergenic
1029147454 7:98457027-98457049 ATGCACCGCCATGCTCCCTGGGG - Intergenic
1032717445 7:134522054-134522076 AGCCACCGCACCGGGCCCAGAGG - Intergenic
1033030579 7:137822119-137822141 AGCCACCGCTCTGTGCCCTGAGG - Intronic
1034349755 7:150408170-150408192 AGCCACGGCCACGGGCCCGAGGG + Intronic
1034949449 7:155287173-155287195 AAGCTCCACCATGGGCCCTGGGG - Intergenic
1035024350 7:155816267-155816289 ACCCACAGTCATGGGGCCTGTGG - Intergenic
1035158640 7:156934796-156934818 AGCCACCCTCCTGGGCACTGAGG + Intergenic
1035334123 7:158114696-158114718 AGCCACCGGCCACGGCCCTGGGG + Intronic
1035404474 7:158588412-158588434 AGCCCACGCCCTGGGCCCTCCGG - Intergenic
1035437382 7:158869178-158869200 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035437393 7:158869217-158869239 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035437403 7:158869255-158869277 TGCCACAGCCACGGGCCCAGAGG - Intronic
1035731126 8:1854154-1854176 AGACACTGCCCTGGGCCCTGGGG - Intronic
1036082186 8:5568669-5568691 TGGCACCACCATGGTCCCTGCGG - Intergenic
1036168491 8:6459969-6459991 AGCCACGGCCACGGGCTCTGGGG + Intronic
1038156923 8:25000095-25000117 AGCCACCAGCAGGGGCGCTGTGG - Intergenic
1038425796 8:27463084-27463106 AGCCTCAGCCTTGGGACCTGAGG + Exonic
1045273454 8:100681061-100681083 AGCCACTTCCCTGGCCCCTGAGG + Intergenic
1045305045 8:100951375-100951397 AGCCTCCGCGCTGGGCGCTGCGG - Intronic
1045508746 8:102797079-102797101 AGCCACAGCCATCACCCCTGTGG - Intergenic
1046923274 8:119757652-119757674 ATCCACCCCCTTGGGCCCTTGGG - Intronic
1049206477 8:141365947-141365969 AGCCAAGGCCAGGGCCCCTGAGG - Intronic
1049385455 8:142340866-142340888 AGACACCTCCCTGGGCCCAGAGG + Intronic
1049465544 8:142749748-142749770 AGCCTCCGCCATCAGCCTTGGGG + Intergenic
1049467226 8:142757113-142757135 AGCCTCCCACATGGGGCCTGGGG - Intergenic
1049753250 8:144295845-144295867 AGCCACCGCGCCTGGCCCTGAGG + Intronic
1049795733 8:144496546-144496568 AGCCTCACCCCTGGGCCCTGGGG + Exonic
1051736718 9:20207767-20207789 AGCCACTACAATGGGCACTGGGG + Intergenic
1053643928 9:40110364-40110386 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1053762224 9:41355125-41355147 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1054456719 9:65435005-65435027 AGCCACTGCCCCAGGCCCTGTGG - Intergenic
1054540821 9:66266245-66266267 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1057146044 9:92760196-92760218 AGGCACCCCCAGGGGCCCAGGGG + Intronic
1057274195 9:93667597-93667619 AGCCCCCGACATGGGCCCAGGGG - Intronic
1059733121 9:117076014-117076036 AGCCTGCTCCATAGGCCCTGGGG + Intronic
1061194418 9:129099996-129100018 GGCCACCCCCCAGGGCCCTGGGG - Intronic
1061328886 9:129880041-129880063 AGCCACCGGCCTGGGCAGTGGGG - Intronic
1061866334 9:133493488-133493510 AGCCACTGCCATGCAGCCTGGGG - Intergenic
1062336785 9:136074757-136074779 GACCACCGACATGGGCCCTCTGG - Intronic
1062527563 9:136984484-136984506 GGCACCCGCCATGGGGCCTGGGG - Exonic
1203746784 Un_GL000218v1:44543-44565 AGCCACAGCCCTCTGCCCTGAGG - Intergenic
1203563322 Un_KI270744v1:74937-74959 AGCCACAGCCCTCTGCCCTGAGG + Intergenic
1185647017 X:1623188-1623210 CGCCACGTCCAGGGGCCCTGGGG - Exonic
1187332476 X:18354053-18354075 AGCCCCCGCCAGGAGCCCGGCGG + Intronic
1191257966 X:58287943-58287965 AGCCACTGCACTGGGCCCAGGGG + Intergenic
1192210004 X:69121857-69121879 CTCCTCCGGCATGGGCCCTGGGG - Intergenic
1192214035 X:69145541-69145563 AGCCAGCACCCTGGCCCCTGGGG + Intergenic
1196820212 X:119695072-119695094 TGCCACCGCCATCCGCCCTATGG - Intergenic
1196919810 X:120574146-120574168 AGCCACCGCACCCGGCCCTGAGG + Intronic
1201151597 Y:11098051-11098073 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1201160112 Y:11159557-11159579 AGCCACAGCCCTCTGCCCTGAGG - Intergenic