ID: 906701873

View in Genome Browser
Species Human (GRCh38)
Location 1:47865363-47865385
Sequence TAAATCAGTACTGCGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906701873_906701886 26 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701886 1:47865412-47865434 TGGGATATGGGGCCTGCTGGTGG 0: 1
1: 0
2: 3
3: 44
4: 363
906701873_906701885 23 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701885 1:47865409-47865431 CACTGGGATATGGGGCCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 227
906701873_906701877 6 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701877 1:47865392-47865414 CTGAACTTCCACCCAAACACTGG 0: 1
1: 0
2: 1
3: 12
4: 107
906701873_906701878 7 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701878 1:47865393-47865415 TGAACTTCCACCCAAACACTGGG 0: 1
1: 0
2: 1
3: 16
4: 143
906701873_906701881 14 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701881 1:47865400-47865422 CCACCCAAACACTGGGATATGGG 0: 1
1: 0
2: 1
3: 9
4: 119
906701873_906701882 15 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701882 1:47865401-47865423 CACCCAAACACTGGGATATGGGG 0: 1
1: 0
2: 0
3: 20
4: 173
906701873_906701879 13 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701879 1:47865399-47865421 TCCACCCAAACACTGGGATATGG 0: 1
1: 0
2: 1
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906701873 Original CRISPR TAAATCAGTACTGCGAGAGG TGG (reversed) Intronic
903408287 1:23117575-23117597 TAAATAAGTACTAAGAGAGGTGG + Intronic
904129649 1:28266229-28266251 TAAATTAGAATTGCGGGAGGTGG + Intronic
906701873 1:47865363-47865385 TAAATCAGTACTGCGAGAGGTGG - Intronic
908903659 1:68984062-68984084 TAAATCAGGATTGCTAAAGGTGG + Intergenic
911998332 1:104796406-104796428 AAAATCAGAAATGAGAGAGGAGG - Intergenic
921564729 1:216702988-216703010 TAAATCAGCACTGTGAGTTGTGG + Intronic
922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG + Intergenic
922664275 1:227455324-227455346 TAAACCAGGACTGGCAGAGGTGG - Intergenic
1065828184 10:29590740-29590762 TAAATCAGCACTGCAGGATGAGG - Intronic
1070842559 10:79497343-79497365 TAAAGCAATACTGACAGAGGTGG - Intergenic
1071060406 10:81564111-81564133 TAAACTAGTAATGAGAGAGGAGG + Intergenic
1081253860 11:40868848-40868870 TAATTCAGTACAGAGAGAAGGGG - Intronic
1085211159 11:74780100-74780122 TACCTAAGTACTGCAAGAGGTGG - Intronic
1086673200 11:89572041-89572063 TAAATCAGGACTACTTGAGGGGG - Intergenic
1093172107 12:15873245-15873267 TAAAGCAGTACTGTGATAAGTGG - Intronic
1097423075 12:59405445-59405467 TAAATTAGTATTGAGAGAGCAGG - Intergenic
1099228355 12:79995005-79995027 TAATTCAGTATAGCGTGAGGTGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1104677871 12:130727142-130727164 TAATTCAGTACAGAGAGTGGGGG + Intergenic
1110759440 13:79215055-79215077 GAAAATAGTACTGAGAGAGGTGG - Intergenic
1111077903 13:83263284-83263306 TAAATTAGTACTGATAGAGTGGG + Intergenic
1116303614 14:43218406-43218428 TAAATTGGTACTGAGAGGGGAGG - Intergenic
1118008246 14:61584625-61584647 GAAAACACTACTGGGAGAGGAGG - Intronic
1118585583 14:67349255-67349277 AAAGTCATTACTGCTAGAGGAGG + Intronic
1131723207 15:95194494-95194516 TGAAACAGTAATGTGAGAGGTGG + Intergenic
1132479939 16:162367-162389 TAAATCAGTAGAGCTGGAGGAGG + Intronic
1134897001 16:17897340-17897362 TAAATTAGAACTGCTAGGGGTGG + Intergenic
1136656935 16:31714928-31714950 TAAAGGAGTATTGCAAGAGGAGG + Intronic
1146525565 17:33564377-33564399 TAAATCAGCACTCCTGGAGGTGG - Intronic
1148438292 17:47698707-47698729 TAAATCAGTGCAGGGAGGGGCGG - Exonic
1149371084 17:55993940-55993962 TAAATTGGTACTGGGAGAGTGGG - Intergenic
1150477032 17:65483571-65483593 TAAAGCAGGAATGAGAGAGGAGG - Intergenic
1152388225 17:79987752-79987774 TAAGTCAGTACTGGGAGATTTGG + Intronic
1153549826 18:6250617-6250639 TAATTCAGCATTGAGAGAGGTGG + Intronic
1154958146 18:21279796-21279818 TAAATCAGGACAGCCACAGGTGG - Intronic
1156499293 18:37546948-37546970 CAAGTCAGTACTGCGAAAGAAGG + Intronic
1163508721 19:17723044-17723066 AACATCAGTACTGTGAGAGGGGG - Intronic
929317498 2:40497493-40497515 TAAATCAGTATTGGGTAAGGGGG + Intronic
933616851 2:84490813-84490835 TAAATCAGCACTTTGGGAGGTGG - Intergenic
937031651 2:118745748-118745770 TAAATTGGTACTGGCAGAGGGGG - Intergenic
938741594 2:134237443-134237465 AAAAGCAGTACTGGGGGAGGAGG + Intronic
944038290 2:195324358-195324380 AAAATCAGTAGTGAGAGAGAGGG + Intergenic
944272324 2:197797222-197797244 TAAATCGGTACTGGTAGAGTGGG - Intergenic
947889182 2:233601846-233601868 AATATCAGTAATGAGAGAGGTGG - Intergenic
1169254647 20:4087514-4087536 TGGATCAGTACTGCGGGAGCTGG + Intergenic
1170812073 20:19681872-19681894 TACATCAGTGCTTTGAGAGGAGG + Exonic
1173587175 20:44191512-44191534 TAAATCAGTAATGCGACTGCTGG + Intergenic
1177003130 21:15638102-15638124 TAAATTTGTACTGCGTGAGTTGG + Intergenic
1177641248 21:23846916-23846938 AAAATTGGTACTGGGAGAGGGGG - Intergenic
1181384398 22:22533298-22533320 TAAATCGGTATTTCCAGAGGTGG + Intergenic
1182341024 22:29620845-29620867 TAAATCAGAGCTGCGTGTGGTGG - Intronic
1183289299 22:36989625-36989647 AAAATCACTACTGGGAGAAGAGG - Intergenic
955869170 3:63418488-63418510 TAAATTAGTACTGGTAGAGAGGG - Intronic
958993464 3:100874163-100874185 TGAATCAGTAATTCGGGAGGTGG + Intronic
968961045 4:3743871-3743893 TAAAGCAGAACTGCAAGAAGAGG - Intergenic
970251670 4:14122914-14122936 TAAATCAGGACAGCAAGATGAGG - Intergenic
976074789 4:81285262-81285284 TAAATCAGTAGTGCTGGAGGGGG - Intergenic
976088124 4:81427251-81427273 TCAATCAGTATTGCCAGAGAGGG - Exonic
977031287 4:91887693-91887715 TAAATCAGTAGGGGTAGAGGGGG + Intergenic
978910447 4:114056915-114056937 TAAATCAGAATTTTGAGAGGTGG - Intergenic
980430260 4:132684762-132684784 TAAATTAGTACTGAGGGAGTGGG - Intergenic
980668464 4:135971551-135971573 CACATCAGTACTGCTAGAAGGGG - Intergenic
986435112 5:7721951-7721973 TAAACCAGTAGTGGGAGTGGAGG + Intronic
986584828 5:9304735-9304757 TAAATCAATACTGAGAAAGTGGG - Intronic
986809334 5:11339385-11339407 AAAAGCAGTACCGCGGGAGGAGG + Intronic
987534929 5:19172853-19172875 TAAATCAGTACTGGGGCAAGAGG - Intergenic
990127100 5:52532181-52532203 TAAATTGGTACTGGGAGAGTGGG - Intergenic
992306631 5:75446906-75446928 GAAATCACTACAGCCAGAGGGGG + Intronic
994749722 5:103722551-103722573 TAAATCGGTACTGGGAGTAGTGG - Intergenic
1002334348 5:178467691-178467713 TAAATCAGTACTAGGAGAAGAGG - Intronic
1004639950 6:17505481-17505503 TAAATCAGAATTGCTAGGGGTGG + Intronic
1012751289 6:103167244-103167266 TAAATCGGTACCGAGAGAGTGGG + Intergenic
1014068249 6:117151565-117151587 TAAATTGGTACTGGGAGAGTGGG - Intergenic
1016643389 6:146377169-146377191 TAAATTGGTACTGGGAGTGGGGG + Intronic
1016989500 6:149919610-149919632 GAACCCAGTACTGAGAGAGGTGG - Exonic
1016993550 6:149945493-149945515 GAACCCAGTACTGAGAGAGGTGG + Exonic
1017004782 6:150022037-150022059 GAACCCAGTACTGAGAGAGGTGG - Exonic
1018106608 6:160493386-160493408 TCATACAGTACTGCGAAAGGTGG + Intergenic
1026564112 7:71475531-71475553 TCAATCAGTAATGGGAGTGGTGG + Intronic
1031521811 7:122776455-122776477 TAAATTAGTACTGGTAGAGTGGG + Intronic
1037036806 8:14178948-14178970 GAAATCAGTTCTGTGATAGGAGG + Intronic
1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG + Intergenic
1041862898 8:62534387-62534409 AATATCAGCACTGCGAGAGAAGG - Intronic
1046175659 8:110571916-110571938 TAAATTGGTACTGGTAGAGGGGG - Intergenic
1046406172 8:113775505-113775527 TATAGCAGTATTGCAAGAGGAGG + Intergenic
1047610643 8:126517564-126517586 TAAATCAGAACTCAGGGAGGAGG - Intergenic
1049539368 8:143200695-143200717 TAAATCAGTACATGGGGAGGGGG - Intergenic
1051914928 9:22197346-22197368 TAAATCGGTACTGGTAGAGTGGG + Intergenic
1061729062 9:132599273-132599295 AAAATCAGTAATGCAAGAGCTGG + Intronic
1188476246 X:30595880-30595902 TAAAGCAGTACTGGTAGGGGAGG + Intergenic
1192676677 X:73203754-73203776 TAAATTAGTACTGGTAGAGTGGG - Intergenic
1195817025 X:108899624-108899646 AAAATCAGAAATGAGAGAGGAGG + Intergenic
1200738514 Y:6827850-6827872 AAACTCAGTACTGCTACAGGCGG - Intergenic
1201777874 Y:17686117-17686139 TAAGTCAATACTGAGAGAGAGGG - Intergenic
1201823684 Y:18219875-18219897 TAAGTCAATACTGAGAGAGAGGG + Intergenic