ID: 906701873

View in Genome Browser
Species Human (GRCh38)
Location 1:47865363-47865385
Sequence TAAATCAGTACTGCGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906701873_906701882 15 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701882 1:47865401-47865423 CACCCAAACACTGGGATATGGGG 0: 1
1: 0
2: 0
3: 20
4: 173
906701873_906701885 23 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701885 1:47865409-47865431 CACTGGGATATGGGGCCTGCTGG 0: 1
1: 0
2: 1
3: 23
4: 227
906701873_906701886 26 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701886 1:47865412-47865434 TGGGATATGGGGCCTGCTGGTGG 0: 1
1: 0
2: 3
3: 44
4: 363
906701873_906701881 14 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701881 1:47865400-47865422 CCACCCAAACACTGGGATATGGG 0: 1
1: 0
2: 1
3: 9
4: 119
906701873_906701877 6 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701877 1:47865392-47865414 CTGAACTTCCACCCAAACACTGG 0: 1
1: 0
2: 1
3: 12
4: 107
906701873_906701878 7 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701878 1:47865393-47865415 TGAACTTCCACCCAAACACTGGG 0: 1
1: 0
2: 1
3: 16
4: 143
906701873_906701879 13 Left 906701873 1:47865363-47865385 CCACCTCTCGCAGTACTGATTTA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 906701879 1:47865399-47865421 TCCACCCAAACACTGGGATATGG 0: 1
1: 0
2: 1
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906701873 Original CRISPR TAAATCAGTACTGCGAGAGG TGG (reversed) Intronic