ID: 906706206

View in Genome Browser
Species Human (GRCh38)
Location 1:47896601-47896623
Sequence CACTAAAATCAGGCAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906706201_906706206 -9 Left 906706201 1:47896587-47896609 CCCAGTCTGTGCGTCACTAAAAT 0: 1
1: 0
2: 0
3: 7
4: 81
Right 906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 24
4: 270
906706202_906706206 -10 Left 906706202 1:47896588-47896610 CCAGTCTGTGCGTCACTAAAATC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 24
4: 270
906706197_906706206 25 Left 906706197 1:47896553-47896575 CCCAAAGATGTTGTAGCGAGAGT 0: 1
1: 0
2: 0
3: 6
4: 64
Right 906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 24
4: 270
906706198_906706206 24 Left 906706198 1:47896554-47896576 CCAAAGATGTTGTAGCGAGAGTG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 24
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906706206 Original CRISPR CACTAAAATCAGGCAGGCTT GGG Intronic
900945653 1:5830126-5830148 CACTAGGATCTGGGAGGCTTTGG - Intergenic
901330709 1:8405923-8405945 AATTAAAATCAGGCCGGCTGCGG - Intronic
902644983 1:17791697-17791719 CAGGCAAATCAGGCTGGCTTCGG - Intronic
902933661 1:19748668-19748690 CACAAAAATTAGCCAGGCGTGGG + Intronic
903453773 1:23472946-23472968 AACTAAAGTCAGACAGACTTGGG - Intronic
904614756 1:31743706-31743728 CACTCAACTGAGGGAGGCTTAGG + Intronic
905599456 1:39236815-39236837 TACAAAAATTAGCCAGGCTTTGG - Intronic
906098500 1:43240507-43240529 CACTACAATCAGCAAGGCCTGGG + Intronic
906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG + Intronic
907262013 1:53225864-53225886 TACTAAAAACAGGCCAGCTTGGG - Intergenic
909186633 1:72495094-72495116 CACTTGAATCCGGGAGGCTTAGG - Intergenic
910561268 1:88594439-88594461 CACTAAAATTAGGCAGCCTATGG + Intergenic
912556472 1:110519859-110519881 CACTGAACCCAGGCAGGCTGGGG + Intergenic
912985043 1:114419050-114419072 CACAAAAATTAGCCAGGCCTGGG + Intronic
914893146 1:151645852-151645874 CACTAAAAGCAGGCAGACTGTGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916666642 1:166973624-166973646 CACTGAAGTCAGCCAGGCATCGG - Intronic
916842059 1:168610638-168610660 CTTTAAAATCAGGCAGACCTGGG + Intergenic
919315737 1:195968877-195968899 TACAAAAATTAGCCAGGCTTGGG + Intergenic
919416631 1:197318722-197318744 AAGTAAAATAAGTCAGGCTTGGG + Intronic
920120611 1:203654136-203654158 CACAAAAATTAGCCAGGCATGGG - Intronic
922187737 1:223290883-223290905 CTTTAAAAACAGTCAGGCTTAGG - Intronic
922655937 1:227383419-227383441 AACCAAAATTAGACAGGCTTAGG - Intergenic
924509793 1:244720350-244720372 TACAAAAATTAGCCAGGCTTGGG - Intergenic
1063667314 10:8070971-8070993 GATTAAAATCTGGAAGGCTTGGG + Intronic
1064815839 10:19260990-19261012 CACTGAAATCAGACCAGCTTAGG - Intronic
1065370662 10:24981802-24981824 TACTAAAGTCAGGTAGGCTCTGG - Intergenic
1065705284 10:28466633-28466655 CACAAAAATTAGCCAGGCGTAGG + Intergenic
1066699894 10:38115931-38115953 CACAAAAATTAGCCAGGCATGGG - Intronic
1066991830 10:42522540-42522562 CACAAAAATCAGCCAGGCATGGG + Intergenic
1067680197 10:48430246-48430268 CACAAAAATTAGCCGGGCTTGGG - Intronic
1069387258 10:67895264-67895286 TACAAAAATCAGCCAGGCTTGGG + Intronic
1070764044 10:79046278-79046300 CACACAAATCAGCCAGGCTGTGG + Intergenic
1072545955 10:96439253-96439275 CACAAAAATCAGCTAGGCATGGG - Intronic
1072572646 10:96672259-96672281 CAGTGAAATCAGGCAGCCTTAGG - Intronic
1072943592 10:99789365-99789387 CTTTAGAATAAGGCAGGCTTTGG + Intronic
1073225334 10:101913686-101913708 CACTAAAGTCTGGGAGCCTTTGG - Intronic
1074635201 10:115307414-115307436 CACAAAAATCAGCCAGGCATGGG - Intronic
1076513147 10:131026358-131026380 CAACGAAGTCAGGCAGGCTTTGG + Intergenic
1080395579 11:31886800-31886822 CCCTAAATTGAGGCATGCTTTGG - Intronic
1082671664 11:56042801-56042823 CACTCAAAACTGGCAGCCTTTGG - Intergenic
1083325669 11:61871859-61871881 CACTCAAGTCAGACAGACTTGGG - Intergenic
1083372599 11:62193807-62193829 CTGGACAATCAGGCAGGCTTGGG - Intergenic
1083621220 11:64050307-64050329 CACTAAACTCAGTCAAGCTCTGG - Intronic
1084075827 11:66775361-66775383 CTCTAAAGTCAGGCAGACTTTGG - Intronic
1084595595 11:70115074-70115096 CACTAAAAGGAGTCAGGCTTGGG + Intronic
1085063551 11:73471222-73471244 CTCTACAATCAGGCAGATTTAGG + Intronic
1085185540 11:74573022-74573044 CACAAAAATTAGCCAGGCGTTGG - Intronic
1089654214 11:119935300-119935322 CCCTAAAATCATGCTGGCTTTGG - Intergenic
1090459219 11:126875075-126875097 CTCTAAAATCACACAGGATTGGG - Intronic
1092673056 12:10884880-10884902 CACTACACTCAGGCAAGCCTTGG + Intronic
1092676660 12:10928587-10928609 CACTACACTCAGGCAAGCGTTGG - Intronic
1092832175 12:12455239-12455261 CCCTAAAAAGAGGCAGCCTTTGG + Intronic
1092862906 12:12735055-12735077 CAGTAAACACAGGCTGGCTTGGG - Intronic
1095138317 12:38633814-38633836 CACCTAAAGCAGGGAGGCTTTGG + Intergenic
1097982781 12:65751543-65751565 AACTAAAATCAGGCTGGGTGCGG + Intergenic
1098001122 12:65944485-65944507 CACCACAATCTGGCAGTCTTTGG + Intronic
1099182325 12:79483016-79483038 GACTCAAATTAGGCAGGTTTGGG + Intergenic
1100767862 12:97887530-97887552 CTCCAAAACCAGGCAGGCTCTGG + Intergenic
1101817415 12:108156215-108156237 CTCTGAAACCAGGCAGGCTCAGG + Intronic
1105368288 13:19781000-19781022 TACAAAAATTAGGCAGGCTTGGG + Intronic
1106408561 13:29495272-29495294 CACTTGAACCCGGCAGGCTTAGG + Intronic
1106428130 13:29653145-29653167 TACAAAAATCAGCCAGGCTTGGG + Intergenic
1106739622 13:32625992-32626014 CACAAAAATTAGCCAGGCGTTGG - Intronic
1106965536 13:35061846-35061868 GAATAAAAGCAGGCAGGCTTTGG + Intronic
1109472506 13:62827732-62827754 CAGTAATATCAGTCAGGCATTGG - Intergenic
1109699043 13:66001649-66001671 CATTTAAATCAGTCTGGCTTTGG - Intergenic
1110777807 13:79431162-79431184 AACTAAAATCAGGCAGAAGTTGG - Intergenic
1111983115 13:95038008-95038030 AACAAAAATTAGCCAGGCTTTGG - Intronic
1114074128 14:19144676-19144698 GAATAAAAGCAGGCAAGCTTTGG + Intergenic
1114088140 14:19255299-19255321 GAATAAAAGCAGGCAAGCTTTGG - Intergenic
1118258345 14:64224598-64224620 CACTAAGATGAGGGAAGCTTGGG + Intronic
1120108553 14:80525293-80525315 TACTAAAGCCAGGCAGACTTAGG + Intronic
1120706284 14:87749519-87749541 CAGTAAAATTAGACAAGCTTTGG - Intergenic
1120876211 14:89378450-89378472 CACTTACAGCAGGCAGACTTGGG - Intronic
1120960783 14:90122864-90122886 AATCAAAATCAGGCAGGCTGTGG + Intronic
1122055813 14:99097601-99097623 TACCAAAATTAGCCAGGCTTGGG - Intergenic
1122512941 14:102284774-102284796 CAAAGAAATAAGGCAGGCTTGGG + Intronic
1124122916 15:26907256-26907278 CACTAAAATGATCCACGCTTTGG - Intronic
1124473367 15:30008797-30008819 CTCAAAGATCAGGAAGGCTTGGG + Intergenic
1124863076 15:33461832-33461854 CATTAAGCTCAGACAGGCTTGGG - Intronic
1125829751 15:42705905-42705927 CACAAAAATTAGCCAGGCGTGGG - Intronic
1126590628 15:50336196-50336218 CACAAAAATTAGCCAGGCATGGG + Intronic
1126665285 15:51070612-51070634 CACTGAACTCAGGCAGACTCTGG - Intronic
1127237402 15:57069925-57069947 CATTAAAATCAAGCTGTCTTGGG + Intronic
1128284265 15:66423409-66423431 CACAAAAATCAAGAAGGGTTGGG - Intronic
1128763345 15:70234746-70234768 CAGTAAAAGCAGGCAGGCTATGG - Intergenic
1128916293 15:71566022-71566044 AACTAAAATCAGGGAGCGTTGGG - Intronic
1129359518 15:75015981-75016003 CACTTAAATGGGGCAGGCATTGG - Intronic
1132007350 15:98240732-98240754 CACTAAAAGGGAGCAGGCTTGGG - Intergenic
1132753213 16:1468599-1468621 AACTAAAAACAGACAGGCTCAGG + Intronic
1133192541 16:4145114-4145136 CACAAAAATCAGCCAGGCGCGGG + Intergenic
1133827472 16:9291230-9291252 CATTAAAATAAGACAGGCCTGGG - Intergenic
1134061827 16:11203929-11203951 CACAAAAATTAGGCGGGCATAGG + Intergenic
1136348765 16:29693977-29693999 TACAAAAATTAGCCAGGCTTGGG - Intronic
1136515390 16:30765087-30765109 GATTAGAATCAGGCAGGATTTGG + Intronic
1137026565 16:35482032-35482054 CAATTCTATCAGGCAGGCTTAGG + Intergenic
1138353829 16:56362234-56362256 CACGGAAATCAAGCCGGCTTTGG + Exonic
1141371382 16:83489477-83489499 CCCTAAATTTAGGCAAGCTTTGG + Intronic
1146042723 17:29472405-29472427 TACAAAAATCAGCCAGGCATGGG - Intronic
1146328104 17:31904426-31904448 CACTAGAATCTGGGAGGCTGAGG - Intergenic
1148386973 17:47241108-47241130 CACTGAATTCAGGCAGATTTGGG + Intergenic
1149036803 17:52143651-52143673 ACCTAAAATCAGGCTGGCTGGGG + Intronic
1150380208 17:64714155-64714177 CACTGGAGTCAGGCAGCCTTGGG - Intergenic
1150776521 17:68086011-68086033 CACTGGAGTCAGGCAGCCTTGGG + Intergenic
1151533711 17:74725151-74725173 CACTAAAATGTGGCAGCCTAGGG + Intronic
1152429995 17:80243550-80243572 TACAAAAATCAGCCAGGCTCAGG - Intronic
1153131312 18:1857953-1857975 CACTCAAAACTGGCAGCCTTTGG + Intergenic
1157765682 18:50295455-50295477 CAATCAAATCAAGCAGGCTCAGG + Intergenic
1159813835 18:73049119-73049141 TACAAAAATCAGGTAGGCATGGG - Intergenic
1164141956 19:22477780-22477802 CACAAAAATTAGACAGGCGTGGG - Intronic
1164664544 19:30018490-30018512 CATTAAAATCAACCAGGCTGTGG - Intergenic
1164974648 19:32563282-32563304 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1166399204 19:42465596-42465618 TACAAAAATTAGCCAGGCTTTGG + Intergenic
1166684695 19:44789340-44789362 CACTAAAATCTGTTATGCTTGGG + Intronic
1167102138 19:47410150-47410172 TACAAAAACCAGGCTGGCTTGGG + Intronic
1167522592 19:49964655-49964677 CATTAAAATCAGGCTGGATGTGG - Intergenic
926623842 2:15072971-15072993 TACAAAAATCAGCCAGGCATTGG + Intergenic
926907511 2:17819717-17819739 TACAAAAATCAGCCAGGCATGGG - Intergenic
929081112 2:38123334-38123356 CTCTAAAGTCAGGCAGACCTGGG + Intergenic
929120128 2:38477345-38477367 CACTCAAATAAGGGGGGCTTGGG - Intergenic
929741173 2:44602158-44602180 CACAAAAATCAGCCAGGTGTGGG - Intronic
929997582 2:46838460-46838482 CACAAAAATCAGCCAGGCCATGG - Intronic
930353908 2:50293164-50293186 CAGGACAATGAGGCAGGCTTGGG - Intronic
931118662 2:59192415-59192437 TACTAAAATCAGGAAGGGGTGGG + Intergenic
931231735 2:60380902-60380924 CTCTACAACCAGGCAGGCTTTGG + Intergenic
931602319 2:64017184-64017206 TACAAAAATCAGCCAGGCGTGGG + Intronic
933119490 2:78519083-78519105 TACTATAATATGGCAGGCTTGGG - Intergenic
934103211 2:88672634-88672656 TACAAAAATTAGGCAGGCATGGG + Intergenic
938488466 2:131741170-131741192 GAATAAAAGCAGGCAAGCTTCGG + Intronic
940168118 2:150797523-150797545 CCCTAAAATCTGACTGGCTTGGG - Intergenic
941127102 2:161597222-161597244 CACCACAATCAAGTAGGCTTGGG + Intronic
942424523 2:175845825-175845847 CACTAACATCAGGCATGACTTGG + Intergenic
942472756 2:176278610-176278632 CACCAAAATATGGCAAGCTTGGG - Intronic
942948271 2:181693900-181693922 CACTAGCTTCAGGCAGGCCTAGG - Intergenic
942986231 2:182145572-182145594 CAAAAAAATTAGCCAGGCTTGGG + Intronic
944431121 2:199634565-199634587 CACAACTATCAGGCAGCCTTTGG + Intergenic
945889470 2:215413271-215413293 TACAAAAATTAGCCAGGCTTGGG - Intronic
946140770 2:217688709-217688731 CACTGAATTCAGGCAGCTTTGGG - Intronic
947787889 2:232840928-232840950 CACTGAAATTAGGAGGGCTTTGG + Intronic
1168871818 20:1135515-1135537 GAAAGAAATCAGGCAGGCTTAGG - Intronic
1169181647 20:3574355-3574377 CACAAAAATTAGCCAGGCATGGG + Intronic
1170073743 20:12396902-12396924 CTCTGGAATCAGGCAGACTTGGG - Intergenic
1170149813 20:13218094-13218116 TACAAAAATCAGCCAGGCGTGGG + Intergenic
1172249331 20:33467829-33467851 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1172827998 20:37806652-37806674 CATTAAAATGAGGTAGGATTTGG + Intronic
1172938447 20:38637900-38637922 CTTTAGAATCAGGCAGACTTGGG + Intronic
1174025982 20:47575409-47575431 AACTTAAATCATGAAGGCTTGGG + Intronic
1174603899 20:51746542-51746564 CACAAAAATCAGTCAGGGCTGGG + Intronic
1174755142 20:53150852-53150874 CACTGAAATTGGGCTGGCTTAGG + Intronic
1175070357 20:56328044-56328066 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1175805166 20:61823603-61823625 CACTAAAATGTGGCAGGATGAGG + Intronic
1178706529 21:34878205-34878227 GAAAAAAATCTGGCAGGCTTTGG + Intronic
1178927783 21:36790487-36790509 CACCAAAATCATGGAGGATTAGG + Intronic
1179616331 21:42585803-42585825 TTCTAAAATGAGGCAGGCATTGG + Intergenic
1179968427 21:44819552-44819574 CACTAAACTCCGGCAGGCTGTGG + Intergenic
1180289776 22:10837616-10837638 GAATAAAAGCAGGCAAGCTTTGG + Intergenic
1180492573 22:15867038-15867060 GAATAAAAGCAGGCAAGCTTTGG + Intergenic
1182507095 22:30791479-30791501 CACAAAAATTAGCCAGGTTTGGG - Intronic
1183873636 22:40760208-40760230 TACAAAAATCAGCCAGGCGTGGG - Intergenic
1184476959 22:44727178-44727200 CCCTAAAGTCAGGCAGACCTGGG - Intronic
949232509 3:1767777-1767799 CACTAAAATCAGACTGCCTAGGG + Intergenic
949980030 3:9496589-9496611 CACTTGAATCAGGGAGGCTGAGG + Intergenic
949991883 3:9586079-9586101 TACAAAAATCAGCCAGGCATGGG + Intergenic
951307351 3:21081689-21081711 AATTAAGATCAGGCAGGGTTAGG + Intergenic
952371236 3:32724711-32724733 CACAAAAATTAGCCAGGCATTGG - Intronic
952499762 3:33949918-33949940 CACAAAAATGAGGAAGGCTGTGG + Intergenic
953103876 3:39856361-39856383 CTCTAAAATCAGGCAGGGAGCGG - Intronic
953198173 3:40753647-40753669 CACTAACATGATGCTGGCTTTGG + Intergenic
955835606 3:63051516-63051538 TACTAAAATCAGACAGACTTGGG - Intergenic
957304174 3:78435113-78435135 TAGTAAAATCAGGCATGCTGTGG - Intergenic
957792344 3:84958291-84958313 CACTGGCATCAGGCAGCCTTTGG - Intergenic
958576482 3:95955302-95955324 CATTGAAGTCAGACAGGCTTTGG + Intergenic
959001307 3:100967345-100967367 TACAAAAATTAGCCAGGCTTGGG + Intronic
959090072 3:101892867-101892889 TGCTAGAATCAGGCAGTCTTTGG + Intergenic
959188755 3:103082540-103082562 CACTAAAGTCAGTCAGGGTTTGG - Intergenic
960845214 3:121998622-121998644 CACTAAAAGCAGGCAAGACTGGG - Intronic
963854593 3:150240774-150240796 CACTAACACCAGATAGGCTTAGG + Intergenic
966226599 3:177604607-177604629 TACAAAAATCAGCCAGGCGTGGG + Intergenic
967592659 3:191296761-191296783 CTCCAAAATTAGGCAGGCCTGGG + Intronic
967843712 3:194028208-194028230 TACAAAAATTAGTCAGGCTTGGG + Intergenic
969493240 4:7511806-7511828 CAGAAAATTCAGGCAAGCTTTGG + Intronic
970168377 4:13263614-13263636 CACTAAAATCTCTCAGGATTGGG + Intergenic
970233594 4:13935908-13935930 AACAGAAATCAGGAAGGCTTTGG + Intergenic
970736467 4:19175100-19175122 CAGTGAAATCATGGAGGCTTTGG + Intergenic
972208964 4:36813942-36813964 CAAAAAAATTAGCCAGGCTTGGG + Intergenic
972580357 4:40390146-40390168 CAGATAAATCAAGCAGGCTTTGG + Intergenic
972636888 4:40892237-40892259 CACTATGCTCAGCCAGGCTTGGG + Intronic
973778672 4:54267758-54267780 CACTAAAAAAAGGCATACTTGGG - Intronic
977647950 4:99435626-99435648 CTCTAAAATCAGCCATGCCTAGG - Intronic
978444558 4:108768143-108768165 CAAAAAAATCAGCCAGGCATGGG - Intergenic
979473644 4:121129430-121129452 CACTAAAATAATGCAAGCATGGG - Intergenic
980070504 4:128238578-128238600 CACTTAAATCAGGGAGGCAGAGG - Intergenic
983248506 4:165317517-165317539 TACAAAAATCAGCCAGGCATGGG - Intronic
984018126 4:174450362-174450384 CACTAAATACAGACAGCCTTCGG - Intergenic
984287402 4:177749668-177749690 CAGTAAAATAAGCCAGGCATAGG - Intronic
984420360 4:179513524-179513546 CACTAAAATGAGGTAGAATTTGG + Intergenic
986724910 5:10587389-10587411 CACTAAAATCTGGCCGGGTGTGG - Intronic
986999865 5:13649494-13649516 CTTTAGAATCAGGCAGGCTGAGG - Intergenic
987503726 5:18744665-18744687 CACTAAAATCGAGCAGCCCTGGG - Intergenic
987507758 5:18795132-18795154 GACTAAAATCAGGGAGTCTGAGG + Intergenic
988101959 5:26691234-26691256 CAGTCAAATCAGTCAGGCCTTGG - Intergenic
988730913 5:33971779-33971801 CACAAAAATTAGCCAGGCATGGG - Intronic
989339187 5:40354783-40354805 CACCAGATTCAGGCAGACTTGGG + Intergenic
990435934 5:55791967-55791989 CACAAAAATTAGCCAGGCATGGG + Intronic
994268414 5:97745641-97745663 TACAAAAATCAGCCAGGCGTGGG - Intergenic
995934121 5:117487502-117487524 CACTAGAATGAGACAGACTTGGG + Intergenic
998105824 5:139468586-139468608 CACCAAAGGCAGGCAGGCTGAGG - Intergenic
998581125 5:143377200-143377222 CACTAAAACAAAGCAGGTTTAGG + Intronic
999667872 5:153932847-153932869 TACTATAATCAGCCTGGCTTTGG - Intergenic
1003500626 6:6700103-6700125 GTCTAAAATCAGGCAGGCGAGGG - Intergenic
1003517311 6:6827735-6827757 CACAAAAATTAGCCAGGCATGGG + Intergenic
1003541337 6:7020740-7020762 TACAAAAATCAGCCAGGCATTGG + Intergenic
1003639526 6:7864777-7864799 CACTAGAAACAGTCAGGGTTGGG + Intronic
1003729011 6:8799486-8799508 CACTAACATCAGGCATGACTTGG - Intergenic
1003790039 6:9536019-9536041 CACAAAAATTAGCCGGGCTTTGG - Intergenic
1004382782 6:15147070-15147092 CACTAAAATCAGGCCTGGTGTGG - Intergenic
1005500580 6:26425863-26425885 CACTTCAAACAGGCAGGTTTTGG - Intergenic
1007336354 6:41157672-41157694 AATTAAAATCAAGCAGGGTTAGG - Intergenic
1012038622 6:94174996-94175018 CACTTAAACCAGGGAGGCTGAGG - Intergenic
1012168444 6:95988548-95988570 TACTAAAAGCAGGCAGCTTTTGG - Intergenic
1015955246 6:138591569-138591591 CAAAAAAATCAGCCAGGCATGGG - Intronic
1016672886 6:146729243-146729265 CACTAAAACCAGGTGGGCTTAGG + Intronic
1017453115 6:154573229-154573251 CCCTAAAACCAGGCAAACTTTGG + Intergenic
1019029952 6:169001297-169001319 CACACAAATGAGGCAGGCTTGGG + Intergenic
1020087396 7:5318170-5318192 TACAAAAATTAGCCAGGCTTGGG - Intronic
1020447254 7:8282294-8282316 CACTCAAAACAGGCAGCTTTTGG - Intergenic
1020603130 7:10301948-10301970 CACTCTAAACATGCAGGCTTAGG - Intergenic
1020806951 7:12801719-12801741 CTTTAGAATCAGGCAGGCCTGGG + Intergenic
1020907304 7:14079494-14079516 CAAAAAAATCAGCCAGGCGTGGG + Intergenic
1022594360 7:31698025-31698047 CACTAAAATGTGGCAGAATTGGG + Intronic
1023621181 7:42074695-42074717 CACTAAAACCAGGCAGTCCCAGG + Intronic
1025206912 7:56998998-56999020 TACAAAAATTAGCCAGGCTTGGG + Intergenic
1027517085 7:79155782-79155804 CACTAGACTGAGGCAGGCATGGG + Intronic
1028934973 7:96454819-96454841 CACTCAAAACTGGCAGCCTTTGG - Intergenic
1029958147 7:104661080-104661102 CACTGATATCAGGAAGGCTTAGG + Intronic
1030383368 7:108839416-108839438 CACTACAATCTGGCAGGATTGGG - Intergenic
1030822498 7:114112451-114112473 CACAAAAATTAGCCAGGCATTGG - Intronic
1032844129 7:135738174-135738196 AACAAAAATCAGGCAGCCCTTGG - Intronic
1033322051 7:140348735-140348757 CACTAACTTCAAGCAGGCGTAGG + Exonic
1033429727 7:141278425-141278447 TACAAAAATTAGCCAGGCTTGGG + Intronic
1034693864 7:153036854-153036876 GGCTAAAATTAGGCAGGCTGTGG - Intergenic
1034874307 7:154711761-154711783 TACTATAATCAGGCACGATTTGG - Intronic
1036140166 8:6200383-6200405 TATTAAAATGAGGCAGGGTTCGG + Intergenic
1036438777 8:8761319-8761341 TACAAAAATTAGGCGGGCTTTGG - Intergenic
1036552528 8:9827947-9827969 GACTCAAATCAGGCAGCCTGGGG + Intergenic
1036922343 8:12869471-12869493 CATTAAAATGAGGCAGAATTGGG - Intergenic
1037476229 8:19260441-19260463 CACAAAAATTAGCCAGGCGTGGG + Intergenic
1038271120 8:26076827-26076849 GACTAAAAGTTGGCAGGCTTCGG - Intergenic
1039102364 8:33954420-33954442 CACCACAATCGAGCAGGCTTTGG - Intergenic
1039663002 8:39487576-39487598 CATTAAAATAAGGCAGAATTTGG - Intergenic
1039744191 8:40409113-40409135 TACAAAAATTAGCCAGGCTTGGG + Intergenic
1041199249 8:55434948-55434970 CACAAAAATCAGCAATGCTTGGG + Intronic
1042311092 8:67380035-67380057 CACAAAAATCAGCCAGGCATTGG - Intergenic
1042352226 8:67788994-67789016 CAGTCCAATCAGTCAGGCTTTGG + Intergenic
1042386925 8:68187362-68187384 CACGGAAAGCAGGAAGGCTTTGG + Intronic
1042774509 8:72414825-72414847 CACTAAAAGCAGTCAGTGTTAGG + Intergenic
1043633157 8:82362789-82362811 TACTAAAATTAGCCAGGCATGGG + Intergenic
1044039275 8:87346123-87346145 CACTTAAATCAGGGAGGCAGAGG - Intronic
1044318982 8:90780957-90780979 GACTAATATGAGGCAGGATTGGG - Intronic
1045514010 8:102841114-102841136 CAACAAAATTAAGCAGGCTTGGG + Intronic
1046356008 8:113086091-113086113 CACAAAAATTAGCCAGGCGTGGG + Intronic
1047338149 8:123955516-123955538 CTTTGAAATCAGGCAGGCCTGGG + Intronic
1047725711 8:127682457-127682479 CACAAAAATTAGCCAGGCATAGG - Intergenic
1050284859 9:4090627-4090649 CACTGGAATCAGACAGGTTTAGG + Intronic
1050857216 9:10374600-10374622 CACTAAACGTAGGCAGGATTAGG - Intronic
1052464471 9:28813026-28813048 AACTATACTGAGGCAGGCTTTGG + Intergenic
1054759417 9:68991337-68991359 CAATAAAACCAGGCATGCTTGGG + Intronic
1055284352 9:74712444-74712466 CACGAGAATCAGTCAAGCTTGGG - Intergenic
1055970360 9:81905800-81905822 CACTAAAATGAGGTAGAATTTGG + Intergenic
1055972547 9:81926238-81926260 CACTAAAATGAGGTAGAATTTGG + Intergenic
1055974300 9:81941310-81941332 CACTAAAATGAGGTAGAATTTGG + Intergenic
1055979327 9:81986549-81986571 CACTAAAATGAGGTAGAATTTGG + Intergenic
1056266611 9:84902998-84903020 AACTATAATGAGGCAGGCTAGGG - Intronic
1057955861 9:99407280-99407302 CTCTGAAATCAGGAAGGCCTGGG + Intergenic
1059224032 9:112654713-112654735 CACTAAAACAAAGCTGGCTTTGG - Intronic
1059392992 9:114010877-114010899 CTTTGAAATCAGACAGGCTTAGG + Intronic
1060512552 9:124244488-124244510 CATAAAAATCAGCCAGGCATGGG - Intergenic
1060674217 9:125497683-125497705 CATTAGAATCAGGCAGACCTTGG - Intronic
1060719946 9:125970059-125970081 CACTAGTATCAGACAGGCTCTGG + Intergenic
1185788573 X:2911215-2911237 CACAAAAATTAGGCAGGTGTGGG + Intronic
1185800778 X:3008702-3008724 CACAAAAATTAGGCAGGTGTGGG - Intronic
1186503687 X:10072963-10072985 CATTGAAATCAAGCAGGGTTGGG - Intronic
1186741451 X:12522684-12522706 CACTTGAATCAGGCAGGCAGAGG - Intronic
1187743905 X:22387570-22387592 CACTATGATCAGGCCTGCTTGGG + Intergenic
1189307422 X:39997355-39997377 CTCTAAAAACATCCAGGCTTTGG - Intergenic
1191653474 X:63568669-63568691 CACTAAAAGTAGGGAGGCTGAGG + Intergenic
1191706611 X:64100659-64100681 CTCTGAAATCAGCCAGTCTTAGG + Intergenic
1191730530 X:64330030-64330052 CTTTAGAATCAGGCAGACTTGGG - Intronic
1193390922 X:80928353-80928375 TACAAAAATTAGCCAGGCTTTGG - Intergenic
1193398271 X:81011940-81011962 CACTAAACTCAGGCAGTGGTTGG + Intergenic
1196976287 X:121161383-121161405 CACTAAAATCAGGGACACTATGG - Intergenic
1197781684 X:130166171-130166193 CAAAAGAATCAGGAAGGCTTCGG - Intergenic
1199412740 X:147543535-147543557 TACTAAAATGAGGAAGGCTTTGG + Intergenic
1202128464 Y:21589107-21589129 CACATTAATGAGGCAGGCTTGGG - Intergenic