ID: 906708273

View in Genome Browser
Species Human (GRCh38)
Location 1:47910607-47910629
Sequence TTGAGCTTCAAGAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906708273 Original CRISPR TTGAGCTTCAAGAAGTGTCC TGG (reversed) Intronic
900895810 1:5482181-5482203 CTCAGCATCAAGCAGTGTCCAGG - Intergenic
906708273 1:47910607-47910629 TTGAGCTTCAAGAAGTGTCCTGG - Intronic
908342402 1:63195097-63195119 TAGAGCCTTAGGAAGTGTCCAGG - Intergenic
909761111 1:79288578-79288600 TTGAGATTTAAGAAGTTTGCAGG + Intergenic
911719744 1:101177918-101177940 TTGAACTTAAAAAAATGTCCTGG - Intergenic
916001070 1:160616247-160616269 TTGTGATTAAAGAAGAGTCCAGG + Intronic
916024328 1:160820722-160820744 TGGAGGTTCAAGAAGGGTTCTGG - Intronic
920661620 1:207920435-207920457 TAGAGCTTGAAGAAGTGGCGGGG - Intergenic
920971376 1:210746128-210746150 TTGATCTTCAGGAACTGTCATGG + Intronic
924550081 1:245067737-245067759 TTGAGCTTCTGGAAGAGCCCTGG + Intronic
1064409205 10:15090822-15090844 TTGAGATGCAAGAAGGGGCCAGG + Intergenic
1072014402 10:91332537-91332559 TAGAGGTTCAACAAGTGTCTTGG - Intergenic
1078296154 11:10072388-10072410 GTGAGCTTCAAGAAGTGAGTAGG - Intronic
1080029809 11:27648566-27648588 TTTAGCTTTCAGAAGAGTCCTGG - Intergenic
1080550409 11:33369507-33369529 TTCAGCTTCAAGACGAGTCCTGG + Intergenic
1081684721 11:45034342-45034364 TTCTGCTTCAAGAAGTTTTCAGG + Intergenic
1081976589 11:47239227-47239249 TGGATCTTCCAGAAGTGACCTGG + Exonic
1085141520 11:74147549-74147571 TTGAGTTTAAAGAAGTCTCCTGG + Intronic
1086408370 11:86519172-86519194 TTGAGCTTTAAGAAATGTACAGG - Intronic
1104571558 12:129930277-129930299 TTGAGCACCATGAAGTGGCCCGG - Intergenic
1106713494 13:32363493-32363515 TGGGGCTTCAAGAGGTGTACAGG - Exonic
1108856135 13:54794974-54794996 TTGAGCTTCCAGAATTGTGAGGG + Intergenic
1109777798 13:67065612-67065634 TTGAGCTTCAAAAATTCTGCTGG + Intronic
1111862790 13:93729242-93729264 TTGAGATTCTAAAAGAGTCCAGG + Intronic
1112862160 13:103845225-103845247 TTCAGTTTCAAGAAATTTCCTGG - Intergenic
1113067326 13:106385542-106385564 TTAAACTTCAAGAAGTGTCTGGG - Intergenic
1114605075 14:23989459-23989481 TTGGGCTCCAGAAAGTGTCCCGG + Intronic
1122266045 14:100547354-100547376 TAGAGCCTCAAGAATTGTCTGGG - Intronic
1123176388 14:106422809-106422831 GTGACCTTGAAGATGTGTCCTGG + Intergenic
1123197244 14:106628328-106628350 GTGACCTTGAAGATGTGTCCTGG + Intergenic
1202947300 14_KI270726v1_random:40761-40783 GTGACCTTGAAGATGTGTCCTGG - Intergenic
1125074204 15:35594011-35594033 ATGAGCTTCAAGAGGTGTGCAGG - Intergenic
1127902670 15:63352523-63352545 ATGACCTCCAAGAAGTGTCATGG - Intronic
1130159326 15:81383281-81383303 TCATGCTTCAAGAAGTTTCCGGG - Intergenic
1134596439 16:15499709-15499731 ATGAGCTGGAAGAAATGTCCAGG - Intronic
1136560974 16:31039044-31039066 TTGAGCTTCCAGCCCTGTCCTGG + Intronic
1141954909 16:87364276-87364298 TTGAGCTTCGTGCTGTGTCCTGG - Intronic
1144170186 17:12652505-12652527 TTGAGCCTAATGAATTGTCCTGG - Intergenic
1147968294 17:44206036-44206058 CTGGGCTTCAAGAAATGTGCTGG - Exonic
1162631039 19:11926984-11927006 GTGAGATTCAAGAACTCTCCTGG - Intronic
1167702978 19:51061379-51061401 TTGAGCTTAAAGAAGAGTTCAGG - Intronic
929872120 2:45767983-45768005 CTGAGCTTCCAGAAGCTTCCTGG + Intronic
933379332 2:81523400-81523422 TTAAGCTTAATGAAGTGTCTAGG - Intergenic
933744274 2:85559406-85559428 TTGAGCTTCAGAAAGTGCTCTGG + Intronic
935130378 2:100256896-100256918 TGGTGCTTCACTAAGTGTCCTGG + Intergenic
935976595 2:108584812-108584834 GTGAGCGGCAGGAAGTGTCCAGG + Intronic
938645707 2:133327982-133328004 TTGAGCCCCAAGTAGTGCCCAGG + Intronic
940146953 2:150555533-150555555 TTCAGCTGTAAGAAGGGTCCAGG - Intergenic
940735811 2:157450719-157450741 TTGTTCTTCATGAATTGTCCTGG - Intronic
941012438 2:160316416-160316438 TTTAGATACAAGAAGTCTCCTGG - Intronic
944667242 2:201968259-201968281 TTGAGCTTCCAGAACTGTGAGGG + Intergenic
945532915 2:210978691-210978713 TTGGGCTTCAAAAAGTTTGCAGG + Intergenic
946688947 2:222296789-222296811 GTGTTCATCAAGAAGTGTCCAGG + Intronic
947061652 2:226173054-226173076 TTCAGTTTCATGAAGTGTCCCGG + Intergenic
947916296 2:233833964-233833986 TTTCCCTTTAAGAAGTGTCCTGG - Intronic
1169572075 20:6917237-6917259 TTGAGTTTCAAAAAGTGTATTGG + Intergenic
1173081990 20:39877322-39877344 TGGAGCTTCAACAAGAGTCTGGG + Intergenic
1175324251 20:58111506-58111528 TTGAGCTCCCAGAACTGCCCCGG + Intergenic
1181014026 22:20058155-20058177 TTGGGGATCAAGAAATGTCCTGG - Intronic
949255578 3:2041786-2041808 TGGAGTTTCAAAAATTGTCCTGG + Intergenic
951972096 3:28457546-28457568 TAGAACTGCAAGAAGTGTACAGG - Intronic
953563507 3:44012715-44012737 TTGCGCTTCATGAGGTGTCCAGG - Intergenic
956914036 3:73851979-73852001 TTGAGCTTCGTGAAATGGCCAGG + Intergenic
957534921 3:81489447-81489469 TTTAGCTTCTAAAAGTGTTCAGG + Intergenic
960439601 3:117670498-117670520 CTGAGCCTGAAGAAGTGTGCAGG - Intergenic
963001717 3:140687875-140687897 TAGAGAATCTAGAAGTGTCCAGG + Exonic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
969017077 4:4110527-4110549 TTAAGCCTCAAGAAGTGTAGTGG + Intergenic
969243243 4:5915828-5915850 TTGAGCTTCTAGAATGTTCCAGG - Intronic
970840967 4:20469121-20469143 TAGGGCTTCAAGAAGTCTTCAGG + Intronic
978650287 4:110996046-110996068 TACAGATTCAAGAGGTGTCCTGG - Intergenic
982817264 4:159901849-159901871 TTGAGTTTTCAGAAGTGCCCAGG - Intergenic
985876742 5:2605359-2605381 TTGACTTTCATGAAGTGTGCCGG + Intergenic
988359428 5:30215711-30215733 TTGACCCTCAGGAAGAGTCCTGG + Intergenic
988892907 5:35638799-35638821 TTGTGCTCCAAGCATTGTCCTGG + Intronic
997737642 5:136225866-136225888 TGGAGCTTTCAGATGTGTCCAGG + Intronic
1000528574 5:162389355-162389377 TAGAGCTTAAAGAAGTGGCCTGG - Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001239120 5:170054870-170054892 GTGACCTTCAACAAGTGGCCTGG + Intronic
1003653818 6:7987122-7987144 CTGAGGTTCAAGTAGTATCCTGG - Intronic
1008461065 6:51772722-51772744 ATCAGCTCCAAGATGTGTCCAGG + Exonic
1013288765 6:108702093-108702115 TTGGGATTCAAGAATTGTCAAGG + Intergenic
1017424797 6:154309349-154309371 TTGTGCTTCAGGTAGTGTGCTGG - Intronic
1017614546 6:156230443-156230465 CTGAGCTTCAGGATGAGTCCAGG - Intergenic
1019441149 7:1047770-1047792 TAAAGCTTCAACAACTGTCCGGG + Intronic
1022173380 7:27850544-27850566 TTGTGGTTCCAGCAGTGTCCTGG - Intronic
1023599536 7:41867715-41867737 TTGTACTTTCAGAAGTGTCCAGG - Intergenic
1024096668 7:45987699-45987721 CTGAGGTTCAGGAAGTCTCCTGG + Intergenic
1024354701 7:48402719-48402741 TTGAGCTTCAAGAATAGTTGGGG - Intronic
1024394768 7:48853463-48853485 TTGATATTCAAGAGGGGTCCTGG + Intergenic
1024400494 7:48919179-48919201 TTGATATTCAAGAGGGGTCCTGG - Intergenic
1028661193 7:93277566-93277588 CTGAGCTACAATAAGTATCCTGG + Intronic
1034920867 7:155080538-155080560 TGGAGCCTCCAGAACTGTCCAGG + Intronic
1044729653 8:95219802-95219824 TTTAGCTTCATGAAGTCTTCGGG + Intergenic
1046115783 8:109781597-109781619 TTAAACCTCAAGAACTGTCCAGG - Intergenic
1046602707 8:116336140-116336162 TTCAACTTGAAGAAGTGTCAGGG - Intergenic
1048046015 8:130774136-130774158 TAGAACTTCAACAAGTGTCTAGG - Intergenic
1048876602 8:138841410-138841432 TGGGGCTTCAAGCAGTTTCCTGG + Intronic
1060785698 9:126450296-126450318 CTGAGCTTCCAGATCTGTCCGGG + Intronic
1186017279 X:5212216-5212238 TCGAGCTTCCAGAGTTGTCCTGG - Intergenic
1187810225 X:23167673-23167695 TTGAGTTTCATGAAGAGTCTTGG - Intergenic
1188588798 X:31809010-31809032 TTGAGAATAAAGAAGAGTCCTGG + Intronic
1194193874 X:90868901-90868923 TGCAGCTGCAAGAAGTTTCCTGG + Intergenic
1194617991 X:96131104-96131126 AAGAGCTTCAAGAAGTGGCTTGG + Intergenic
1196983462 X:121241493-121241515 TTGAGCTTCCAGAAGGAACCAGG - Intergenic
1197879195 X:131147015-131147037 TTCAGCTTTAAAAAGTGCCCAGG + Intergenic
1200540484 Y:4451285-4451307 TGCAGCTGCAAGAAGTTTCCTGG + Intergenic
1200750256 Y:6938407-6938429 TAGAGCTTCCAGAAATGTCATGG - Intronic
1201049857 Y:9921784-9921806 TTGAGATTCAAGTTGGGTCCAGG + Intergenic
1202114232 Y:21454766-21454788 TTGAGATTCAAGTTGGGTCCAGG - Intergenic