ID: 906708319

View in Genome Browser
Species Human (GRCh38)
Location 1:47910960-47910982
Sequence GGCCATTCCAGCCTTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906708319_906708332 28 Left 906708319 1:47910960-47910982 CCTTGCCCAAGGCTGGAATGGCC 0: 1
1: 1
2: 3
3: 19
4: 200
Right 906708332 1:47911011-47911033 GAGGCAATTCCTGGTGATGGTGG 0: 1
1: 0
2: 1
3: 28
4: 251
906708319_906708327 9 Left 906708319 1:47910960-47910982 CCTTGCCCAAGGCTGGAATGGCC 0: 1
1: 1
2: 3
3: 19
4: 200
Right 906708327 1:47910992-47911014 ATGGAGCCACCTTTGATCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
906708319_906708331 25 Left 906708319 1:47910960-47910982 CCTTGCCCAAGGCTGGAATGGCC 0: 1
1: 1
2: 3
3: 19
4: 200
Right 906708331 1:47911008-47911030 TCGGAGGCAATTCCTGGTGATGG 0: 1
1: 0
2: 0
3: 9
4: 114
906708319_906708330 19 Left 906708319 1:47910960-47910982 CCTTGCCCAAGGCTGGAATGGCC 0: 1
1: 1
2: 3
3: 19
4: 200
Right 906708330 1:47911002-47911024 CTTTGATCGGAGGCAATTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 44
906708319_906708326 6 Left 906708319 1:47910960-47910982 CCTTGCCCAAGGCTGGAATGGCC 0: 1
1: 1
2: 3
3: 19
4: 200
Right 906708326 1:47910989-47911011 AGGATGGAGCCACCTTTGATCGG 0: 1
1: 0
2: 1
3: 11
4: 147
906708319_906708324 -10 Left 906708319 1:47910960-47910982 CCTTGCCCAAGGCTGGAATGGCC 0: 1
1: 1
2: 3
3: 19
4: 200
Right 906708324 1:47910973-47910995 TGGAATGGCCAGGCAGAGGATGG 0: 1
1: 3
2: 2
3: 70
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906708319 Original CRISPR GGCCATTCCAGCCTTGGGCA AGG (reversed) Intronic
900246547 1:1638810-1638832 GGCCATCCCAGCCAGGTGCAAGG + Intronic
900257773 1:1705952-1705974 GGCCATCCCAGCCAGGTGCAAGG + Intronic
900435703 1:2629572-2629594 GGCCCTTCCAGCCTCGGGCCGGG - Intronic
901207320 1:7504457-7504479 GGCCTTCTCAGCCTCGGGCAGGG + Intronic
904332188 1:29767349-29767371 GGCGAGACCAGCCTAGGGCAGGG - Intergenic
905370340 1:37479653-37479675 GGCGACTCCAGCCTTCAGCATGG - Intronic
905807498 1:40887407-40887429 AGCCATTGCAGGTTTGGGCAGGG + Intergenic
905915817 1:41683596-41683618 GGCCATACCAGCCCTGAGCCAGG - Intronic
906708319 1:47910960-47910982 GGCCATTCCAGCCTTGGGCAAGG - Intronic
907417499 1:54324570-54324592 GGCCTCTCCAGCCTTGGTGATGG - Intronic
912541642 1:110420729-110420751 GCCCTTTCCAGCCTCTGGCAGGG + Intergenic
914846838 1:151288175-151288197 GGCCTTGCCTGCCTTGGGCAAGG + Exonic
915476278 1:156154581-156154603 GGCCCTCCCAGCCCTGGGCCTGG + Exonic
915536070 1:156536215-156536237 GGGCATTCCAGCCTGGGCAATGG + Intronic
916091414 1:161310189-161310211 CAACATTCCAGCCTGGGGCAGGG - Intergenic
916127198 1:161581919-161581941 GGCCAGTGCTGCCTTGGGTAAGG + Intronic
916137118 1:161663723-161663745 GGCCAGTGCTGCCTTGGGTAAGG + Intronic
916852022 1:168713495-168713517 AGGCATTTCTGCCTTGGGCAAGG - Intronic
917789609 1:178491132-178491154 GCCCAGTCCAGCCTCAGGCAGGG - Intergenic
918128577 1:181605399-181605421 TGCCAGTGCTGCCTTGGGCATGG - Intronic
919755079 1:201061627-201061649 GGCCATTCCAGGATTGGGTCTGG - Intronic
919895438 1:202007081-202007103 GCCCAGTGAAGCCTTGGGCATGG - Intergenic
919970645 1:202575312-202575334 GGACATACCAGCCTAGGTCAAGG + Intronic
920036332 1:203068150-203068172 GGCCATTCCAGCTTGGGTCAGGG + Intronic
920057017 1:203200106-203200128 CTCCATTCCAGCATTCGGCAGGG - Intergenic
922217751 1:223534385-223534407 GGCCTTTCCAGCCCAGGGAATGG + Intergenic
922582721 1:226710720-226710742 GGCCCTGCCAGCCTGGGGTAGGG + Intronic
1062896697 10:1108795-1108817 GGTCTTCCCAGCCTGGGGCAGGG - Intronic
1063735826 10:8753183-8753205 GGCCATTCTATCCTTGTGCCAGG + Intergenic
1064016118 10:11773656-11773678 GGCCACTCCAGCCTTTGGTCAGG - Intergenic
1064322756 10:14320854-14320876 GGGCATTCCAACCTGGGCCATGG - Intronic
1065358765 10:24869361-24869383 GCCCATTACAGCCCTGGGGAAGG - Intronic
1069908820 10:71747775-71747797 AGCCATGTCTGCCTTGGGCACGG - Exonic
1070092019 10:73296289-73296311 GAACAGTCCTGCCTTGGGCATGG - Intronic
1070322068 10:75362018-75362040 AGCCACTGCAGCCTTGGGAAGGG - Intergenic
1071475804 10:86024126-86024148 GCCCATTCCAACCCTGGTCATGG - Intronic
1071679795 10:87693228-87693250 GGCCATGCCAGCCTGGCTCAAGG - Intronic
1073106883 10:101037187-101037209 GGCGATTCCTGCCATGGGTAAGG + Exonic
1075406574 10:122199514-122199536 GCCCTTCCCAGCCTGGGGCAGGG + Intronic
1075813250 10:125244313-125244335 TGCCATTTCAGACTTGGGAATGG - Intergenic
1076171042 10:128320167-128320189 GGCCATTTCGGCCTTGGCCTGGG + Intergenic
1076188550 10:128467120-128467142 GGCCCTTCCAGCTCTGGGCTTGG - Intergenic
1077894303 11:6442411-6442433 GGCCCTTTCAGCCTTGGCTAGGG - Intronic
1079011229 11:16830013-16830035 GTGCATTCCAGCCTTGGTGACGG - Intronic
1080053594 11:27882449-27882471 GGCCATTCCAGTTTTGGAGAGGG + Intergenic
1081803114 11:45873112-45873134 GGCCCTTCCTCCCTTGGGAAAGG - Intronic
1083505953 11:63157381-63157403 GGCAATGCCAGCCTTGTGCAGGG - Intronic
1084038997 11:66530840-66530862 GGACCTGGCAGCCTTGGGCACGG - Intronic
1089000840 11:115050896-115050918 GGTCAGTCCAGCTATGGGCACGG + Intergenic
1096070618 12:48773686-48773708 GGCCACAGCACCCTTGGGCAGGG + Intronic
1096429573 12:51531868-51531890 GGGCAGTCCAGCCTGGGGAAGGG - Intergenic
1096574312 12:52543255-52543277 GGCCAGTCCTGCCTTGGTAAGGG - Intergenic
1099505393 12:83470080-83470102 GGTCATTCCAACCTTAGGGAAGG - Intergenic
1100805521 12:98279273-98279295 GACCAATCCAGCCTTGGGCATGG + Intergenic
1102971147 12:117167837-117167859 GCCCATCACAGCCTTGGGCTGGG + Intronic
1103241724 12:119419053-119419075 GGCCATTTCTGCCTTGTGCTTGG + Intronic
1113000087 13:105625036-105625058 AGCCATTCCAGCCATGGGTGGGG + Intergenic
1119712195 14:76830322-76830344 GGCAAGTCCAGCCTATGGCAGGG - Intronic
1120225828 14:81790241-81790263 AGCCATTCCAGCTTTAGCCATGG + Intergenic
1120957318 14:90094138-90094160 TGGCATGCCAGCCTTGTGCAAGG - Intronic
1121215560 14:92244915-92244937 GGCCACTCCAGCTTTAGCCAAGG - Intergenic
1121667684 14:95685630-95685652 GGCCAGCCCATCCTTGGCCATGG - Intergenic
1122807015 14:104264878-104264900 GGCCTCCCCAGCCTTGGGTAAGG + Intergenic
1123064038 14:105607155-105607177 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123073352 14:105652798-105652820 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123093277 14:105751565-105751587 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1124106381 15:26741643-26741665 GGGCACTCCAGCCTGGGGGACGG - Intronic
1125512072 15:40297479-40297501 GGACATTTGAGCCTTGGGCCTGG - Intronic
1128780041 15:70353332-70353354 GGCCATTCCACATTTGGGCAGGG + Intergenic
1129393578 15:75232678-75232700 GGACAGTCCAGCCTGGGCCAGGG - Intergenic
1131360173 15:91783746-91783768 GGCCAAGGCAGCCTTAGGCATGG - Intergenic
1132051219 15:98609331-98609353 GGCCTTTTCAGCCTTGGCCCAGG - Intergenic
1132559568 16:587254-587276 GGCCAAGCCAGGCCTGGGCAGGG - Intergenic
1132945196 16:2528471-2528493 TGCCATCCCTGCCTTGGGCCTGG + Exonic
1133625863 16:7569819-7569841 GATCATTCCAGTCTTGGGAATGG + Intronic
1134370776 16:13622138-13622160 GACCATTCCAGTCTGGGTCAGGG + Intergenic
1134628065 16:15737078-15737100 GGTCATTCCCGCCTTAGACAGGG + Intronic
1134669120 16:16041597-16041619 GGAAATTCCAGCCTAGGACAGGG - Intronic
1135503895 16:23019953-23019975 GGGCAGTCCAGCCCTGGGCAGGG + Intergenic
1137616937 16:49854404-49854426 AGCCATTCCAGCCAGGCGCAAGG + Intronic
1138558735 16:57787707-57787729 GGGCAGGCCAGCCTCGGGCAGGG - Intronic
1139582976 16:67884161-67884183 TGCCATCCCACCCCTGGGCAAGG - Exonic
1142282751 16:89157049-89157071 GGCCCTTCTAGCCCTGGCCAAGG + Intergenic
1144696421 17:17306752-17306774 GGCAAGTGCAGCCTTGCGCAGGG - Intronic
1146207572 17:30918092-30918114 GGTCATGACAGCCTTTGGCATGG + Intronic
1146489585 17:33270712-33270734 GGGCAATCCAGCCTTTGTCAGGG - Intronic
1149500736 17:57150409-57150431 GGCCATACCACTCTTGGGCATGG + Intergenic
1150615850 17:66770850-66770872 AGCCAGCCCAGCCTTTGGCAAGG - Intronic
1151553175 17:74833748-74833770 GTTCATGCCAGCCTTGGGCAGGG + Intronic
1151675547 17:75595638-75595660 GGCCGGTCCTGCCTTTGGCATGG + Intergenic
1152461173 17:80443303-80443325 GGCTGCTCCAGGCTTGGGCAAGG + Intergenic
1152504311 17:80737551-80737573 CACCACTCCAGGCTTGGGCATGG + Intronic
1152726615 17:81949923-81949945 ACCAATGCCAGCCTTGGGCATGG - Intergenic
1153911632 18:9709882-9709904 GGCCATTTCAGCCTCAGGAAAGG + Intronic
1161447762 19:4327831-4327853 GCCCAGTCCAGGGTTGGGCAAGG - Intronic
1162530053 19:11230775-11230797 GCCCAAGCCAGGCTTGGGCAGGG - Intronic
1163032620 19:14554239-14554261 GGCAGTTCCAGCCCCGGGCAGGG + Intronic
1163797430 19:19345666-19345688 AGCCAATCCAGCCTTGGGGGTGG - Intronic
1163837026 19:19581305-19581327 GGCCCCTCCAGCCTCAGGCACGG - Intronic
1164179444 19:22806752-22806774 GGCCACTCTCGGCTTGGGCAAGG - Intergenic
1165391280 19:35540357-35540379 GCCCATGACAGCCTTGGGGAGGG + Intronic
1166194545 19:41197339-41197361 GTCCATTCCAGCCTAGCCCAGGG - Intronic
1166552443 19:43675181-43675203 GGCGAGGGCAGCCTTGGGCAGGG - Intergenic
1166622523 19:44314519-44314541 GGCAATTCCAGCCATGGGTTTGG + Intergenic
925670895 2:6309017-6309039 GGCCATTCTTGCCTAGGACATGG - Intergenic
926053083 2:9757147-9757169 GGGGATTCAAGCCCTGGGCAGGG - Intergenic
926165637 2:10521093-10521115 GCCCAGTCCAGGCTGGGGCAAGG + Intergenic
926895235 2:17679774-17679796 GGCGATTCCAGAGCTGGGCAGGG - Intronic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
930566257 2:53024303-53024325 GGCATATCCTGCCTTGGGCAAGG + Intergenic
931797379 2:65724028-65724050 AGCGATTCCATCCTTGAGCATGG + Intergenic
931900767 2:66785457-66785479 GCCCATTCCAGCCTTCCACATGG + Intergenic
932659933 2:73642947-73642969 GGTCATTTCAGCCATGAGCAAGG + Intergenic
932666502 2:73702607-73702629 GGTCATTTCAGCCATGAGCAAGG + Intergenic
935427437 2:102934756-102934778 AGCCATTGCTGCCTGGGGCATGG + Intergenic
937853596 2:126656742-126656764 GGCAACTCCAGCCTTGCCCAGGG + Intronic
937880535 2:126861179-126861201 GGCCATACCTGCCCTGAGCAGGG - Intergenic
938584011 2:132671094-132671116 GGCCATCCCAGCCTCGGACTCGG + Intronic
944038157 2:195322624-195322646 GGCCTTGCCAGCCTTAGGGAGGG - Intergenic
945923545 2:215780325-215780347 GGCAATTCAGGGCTTGGGCAGGG + Intergenic
946430930 2:219627268-219627290 GGCCCCTCCAGTCTTGGGAACGG - Intergenic
948534058 2:238632920-238632942 AGCCATGCCAGCCTCGGGGATGG + Intergenic
948792919 2:240388527-240388549 GGCCAGCCCAGCCCTGAGCAAGG + Intergenic
948856779 2:240733967-240733989 GCCCGTGCCAGCCTGGGGCAGGG - Intronic
1169091374 20:2863145-2863167 GGGCATTACAGCCTTGGGTGGGG + Intronic
1169483448 20:6006243-6006265 GGCCATGCTAGCCTTGCGCGTGG + Exonic
1170119896 20:12900430-12900452 GGCCATGCCTGCCTTGCTCAGGG - Intergenic
1170128206 20:12989026-12989048 GGCCACTACTGCCTTGGGCCTGG - Intergenic
1170620403 20:17990969-17990991 GCCCATTACAGCCCTGGGGAAGG + Exonic
1171224006 20:23425383-23425405 GGCCACTGCAGACCTGGGCAGGG - Intergenic
1173782986 20:45771898-45771920 GTCCATTTCAGCCTTGGTCCTGG - Intronic
1173930112 20:46811245-46811267 GGGCTTTCCAGCCTGGGGCTTGG - Intergenic
1175795470 20:61767761-61767783 GGACACTGCAGCCCTGGGCAGGG + Intronic
1177001423 21:15618233-15618255 GGCCATCCCATCTTTGGGAAGGG + Intergenic
1177885403 21:26740529-26740551 GGCCATTCCAGTATTGCACAAGG + Intergenic
1180197508 21:46206566-46206588 GGCCCTTGCAGCCTCGGGCAAGG + Intronic
1181528638 22:23503515-23503537 GTGGATTCCAGCTTTGGGCAGGG + Intergenic
1181559228 22:23690317-23690339 GGCCATCCCAGCCCTGGCCAAGG - Intronic
1182719230 22:32384241-32384263 GGCCATTTCAGCCCTTGGCAGGG - Intergenic
1183374302 22:37454077-37454099 GGCAGTTCCAGCCTTGGGGAGGG - Intergenic
1184521533 22:44997303-44997325 GGTGATTCCAGCCATAGGCATGG - Intronic
950365440 3:12480286-12480308 GCCCATTCCAGCCTTGCACATGG + Intergenic
950880590 3:16319869-16319891 GGCAAGTCCAGCCTGGGGAATGG + Intronic
951363887 3:21757171-21757193 CGCCACTCCAGCCTGGGGCCTGG - Intronic
953707356 3:45241252-45241274 GGCCATGCCAGCCTTGGGCAGGG + Intergenic
953914097 3:46906852-46906874 GGCCATGGCAGCCTTGGGCTGGG - Intergenic
953916935 3:46926343-46926365 GGCCTTCCCAGCCTTGCACATGG - Intronic
954363419 3:50134201-50134223 GGACATCCCTGCCTTGGGCAAGG - Intergenic
954609761 3:51938062-51938084 GGGCAGGCCAGCCATGGGCAGGG - Intronic
954744160 3:52777684-52777706 GGCCATGCCTGCCCTGGGCTCGG + Exonic
956238552 3:67103861-67103883 GGCCAATCCAGCTTTAGCCATGG + Intergenic
959319307 3:104850669-104850691 GGCCCTTCCAGATTTGGGAAGGG - Intergenic
962235387 3:133702232-133702254 GGCCCCTCCAGCTCTGGGCAGGG + Intergenic
962250541 3:133833470-133833492 GGCCTCTCCAGCCTTGCTCAAGG - Intronic
968476034 4:809277-809299 GGCCCCTTCAGCCTTGGGTAGGG + Intronic
969195790 4:5562853-5562875 GGCCATGAGGGCCTTGGGCATGG - Exonic
969410058 4:7022177-7022199 GGCACTTCCAGCCTGGAGCAGGG + Intronic
970276334 4:14405083-14405105 AGCACTGCCAGCCTTGGGCAGGG - Intergenic
976806001 4:89047642-89047664 TGCCAACCCAGCCTAGGGCATGG - Intronic
987401909 5:17486648-17486670 GGCTATTCCAGCCATGGCAATGG - Intergenic
987402838 5:17495735-17495757 GGTCATTCCAGCCATGGCTACGG + Intergenic
987405341 5:17518782-17518804 GGCTATTCCAGCCATGGCAATGG - Intergenic
987405786 5:17522216-17522238 GGCTATTCCAGCCATGGCAATGG - Intergenic
987406233 5:17525650-17525672 GGCTATTCCAGCCATGGCAATGG - Intergenic
987406679 5:17529084-17529106 GGCTATTCCAGCCATGGCAATGG - Intergenic
987407466 5:17585321-17585343 GGCTATTCCAGCCATGGCAATGG + Intergenic
987408165 5:17590523-17590545 GGCTATTCCAGCCATGGCAATGG + Intergenic
987408612 5:17593957-17593979 GGCTATTCCAGCCATGGCAATGG + Intergenic
987409068 5:17597391-17597413 GGCTATTCCAGCCATGGCAATGG + Intergenic
987409635 5:17602044-17602066 GGTCATTCCAGCCATGGCTACGG + Intergenic
987409997 5:17605196-17605218 GGCTATTCCAGCCATGGCAATGG - Intergenic
987411523 5:17619821-17619843 GGTCATTACAGCCATGTGCATGG + Intergenic
987412926 5:17632503-17632525 GGCTATTCCAGCCATGGCAATGG - Intergenic
987413200 5:17634875-17634897 GGCTATTCCAGCCATGGCAATGG - Intergenic
987414581 5:17649461-17649483 GGCTATTCCAGCCATGGCAATGG - Intergenic
987416645 5:17669441-17669463 GGTCATTCCAGCCATGGGCATGG + Intergenic
988514769 5:31894923-31894945 GGCAACTCCAGCCTGGGCCATGG - Intronic
989073178 5:37533648-37533670 GCTCATTCCCTCCTTGGGCATGG + Intronic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
993547012 5:89224711-89224733 GGCCATACCAATCTTGAGCAAGG - Intergenic
994000964 5:94778596-94778618 GGCCATTCCAAACCTCGGCAAGG + Intronic
995039024 5:107567566-107567588 GGACATCCCAACCTGGGGCAGGG - Intronic
998040978 5:138950923-138950945 GGCCCTGCCAGCCATGGTCACGG - Intronic
999045138 5:148459141-148459163 GGACATTCCAGGCATGGGCATGG + Intronic
999726211 5:154440381-154440403 CCCCATTCCAGCCTTGGCAACGG + Intergenic
1000257924 5:159558523-159558545 TACCATTCCCACCTTGGGCATGG - Intergenic
1001029341 5:168250499-168250521 TTCCATTCCTGCCTTGGGGATGG - Intronic
1001641495 5:173247133-173247155 GGGCATTCAAGCATTGGGCCAGG - Intergenic
1001835104 5:174825041-174825063 TGCCATTCCTGCCTTGGTTAAGG + Intergenic
1002323061 5:178387189-178387211 GGCCATTGAAGACTCGGGCAGGG - Intronic
1002651326 5:180697948-180697970 GGCCACTCCAGCCACAGGCAAGG - Intergenic
1006385904 6:33730779-33730801 GGCCATGCCAGACGTGGGGATGG + Intronic
1006795393 6:36729014-36729036 CGCCACTCCAGCCTTGGGTTTGG - Intronic
1011850356 6:91620115-91620137 GGCCAGCCCAGCCCTGGCCATGG + Intergenic
1019489114 7:1302945-1302967 GGCCACTCCGGCCTTGGTCTGGG - Intergenic
1022133084 7:27422087-27422109 TTCCATTCCAGCCCTGGGCTGGG - Intergenic
1022889448 7:34681632-34681654 GGCCATCCCAGCCTCCAGCATGG + Intronic
1023031140 7:36091499-36091521 GCCCATTCCTCCCCTGGGCAGGG - Intergenic
1023620563 7:42067676-42067698 GGCCATACTAGACTTGGCCATGG + Intronic
1026892838 7:73992452-73992474 GTCCAGTCCCGCCTGGGGCAAGG + Intergenic
1028796219 7:94907525-94907547 GGCCTCTCCGGCCTGGGGCAAGG - Intronic
1029530708 7:101123397-101123419 GGACATTCCATCCTTGGGCACGG - Intergenic
1029571686 7:101373990-101374012 GACCAATTCAGCCTGGGGCAGGG + Intronic
1031972960 7:128077083-128077105 GGCCAATCCAGCCCTGTGCAGGG - Intronic
1033519505 7:142146619-142146641 GGCCATTTCAGGCTTGAGGAAGG + Intronic
1033911912 7:146274221-146274243 GGCAATGCCAGCCATGGGCAGGG + Intronic
1034940307 7:155226437-155226459 GGCCAGGACAGCCTTGTGCAGGG + Intergenic
1038725954 8:30082850-30082872 GGTCGTTCCAGCCCAGGGCAGGG + Exonic
1040530206 8:48260649-48260671 GGGCATTCCGGCCTAGGGGAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1044073298 8:87788788-87788810 GGGCATTCCAGCCATGGTGATGG + Intergenic
1048087667 8:131201617-131201639 AGCCATTCCAGCTCTGGCCATGG + Intergenic
1049003656 8:139841563-139841585 GGCCAATCCATCCCAGGGCAAGG + Intronic
1049004584 8:139846708-139846730 GGCCATCCCGGAGTTGGGCATGG + Intronic
1053313131 9:37032004-37032026 GTCCACTCCAGCCTGGGTCAGGG - Intronic
1056796577 9:89662820-89662842 GGCCAGGGCAGCCATGGGCAGGG - Intergenic
1057216221 9:93230316-93230338 GGACCCTGCAGCCTTGGGCAGGG + Intronic
1060233060 9:121839794-121839816 AGCCTTCTCAGCCTTGGGCAGGG + Intronic
1061904150 9:133688084-133688106 TGCCACGCCAGCCTTGGACAGGG - Intronic
1062600851 9:137318061-137318083 GCCCATTCCTGCCGTGGGCCTGG - Intronic
1187853134 X:23610800-23610822 GGCCTTTGGAGCCTTTGGCAAGG - Intergenic
1188168662 X:26893202-26893224 GGCAATTGCAGCTGTGGGCAGGG - Intergenic
1189349641 X:40267021-40267043 GGTCTAGCCAGCCTTGGGCAGGG - Intergenic
1197826347 X:130594466-130594488 GTCCATTCTTGCCTTGGGTAGGG - Intergenic