ID: 906711538

View in Genome Browser
Species Human (GRCh38)
Location 1:47933986-47934008
Sequence ATGGCTAAGGGTTGTTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906711538 Original CRISPR ATGGCTAAGGGTTGTTTTAT TGG Intronic
904605404 1:31695356-31695378 AGGGGTGAGGCTTGTTTTATAGG - Intronic
905925184 1:41744663-41744685 GCGGCTAAGCGTGGTTTTATAGG + Intronic
906711538 1:47933986-47934008 ATGGCTAAGGGTTGTTTTATTGG + Intronic
909604562 1:77495538-77495560 ATGGTTTAGGGTACTTTTATGGG - Intronic
911464054 1:98229140-98229162 ATTACTAAGACTTGTTTTATTGG - Intergenic
912113853 1:106379329-106379351 ATGCCTATGGGTAGTTTTCTTGG + Intergenic
913395633 1:118368363-118368385 ATGGCTCAGGGTTTCTTTTTAGG - Intergenic
915766708 1:158370420-158370442 ATGGAAAAGGTTTGTCTTATGGG + Intergenic
917888846 1:179416857-179416879 GTGGGTAAAGGGTGTTTTATTGG - Intronic
918703902 1:187637892-187637914 ATGGCTAAGGGCTGACTGATGGG - Intergenic
921128844 1:212201969-212201991 ATTGTTAATGCTTGTTTTATGGG + Intergenic
921473193 1:215572708-215572730 ATGGCTAAGGGATGTTTCCCAGG - Intronic
924200887 1:241657363-241657385 ATGTCTTTGGGGTGTTTTATGGG - Intronic
1063498549 10:6532093-6532115 ATGCCGAAGGATTGTTTAATCGG + Intronic
1063649930 10:7924902-7924924 ATGGCTAAGGGTTCTACTTTTGG + Intronic
1064354609 10:14605449-14605471 ATGACTAAGGGCTTATTTATGGG + Intronic
1068638804 10:59378617-59378639 ATGGCAAAGTGTTAGTTTATTGG - Intergenic
1070484861 10:76920545-76920567 TGGGCTAAGGGTTTTTTCATGGG + Intronic
1072405076 10:95143705-95143727 ATTTCTATGGGTTGTTATATGGG - Intergenic
1072792901 10:98331549-98331571 GTGGCAAGGGGCTGTTTTATGGG + Intergenic
1075132588 10:119752755-119752777 GTTGCTAAGGGTTGTATTTTGGG + Intronic
1077542399 11:3153223-3153245 ATGGCATAGGGTTGTTTCAAGGG + Intronic
1078195068 11:9130391-9130413 TTGGCTAAAGGTTTATTTATCGG + Intronic
1078506700 11:11955548-11955570 GTGGCTAATGGCTGTTGTATTGG + Intronic
1079486007 11:20936471-20936493 ATGACTACTGTTTGTTTTATTGG + Intronic
1080060284 11:27949555-27949577 ACGGCTAAGGCCTGTTTTATGGG - Intergenic
1085369413 11:75985443-75985465 ATGGATATGGGTTCTTTTTTTGG + Intronic
1086482500 11:87257743-87257765 ATGGGTAAGGGTTTTTTTTAGGG + Intronic
1086924508 11:92625655-92625677 ATGGCTATTTGATGTTTTATGGG + Intronic
1092447593 12:8571865-8571887 ATGGCTAATTTTTGTTTTTTTGG + Intergenic
1096832458 12:54325045-54325067 TTGGGTAAGGCTTGCTTTATTGG - Intronic
1098361248 12:69656463-69656485 ATTGTTAAGGGGGGTTTTATGGG - Intronic
1100070956 12:90717120-90717142 ATGGCAAATAGTTGTTTCATTGG - Intergenic
1100736277 12:97536845-97536867 CTGGCTAAGGGGAGATTTATGGG - Intergenic
1100764289 12:97846316-97846338 AGAGCTAAGGGTTGTCTTGTTGG - Intergenic
1103021437 12:117537942-117537964 ATGGGGAAGGGCCGTTTTATGGG - Intronic
1103618002 12:122167305-122167327 CTGGGTAAGGGTTGTTTGGTGGG - Intergenic
1106657008 13:31757252-31757274 ATGGCTAAGGGTGGGCCTATGGG + Intronic
1109746744 13:66633453-66633475 ATGGCTAATATTTGTATTATTGG - Intronic
1110002557 13:70223069-70223091 AAGGCTTTGGCTTGTTTTATTGG + Intergenic
1111838747 13:93423115-93423137 ATTACTACAGGTTGTTTTATAGG - Intronic
1112521240 13:100097272-100097294 ATAGTTAAGGGTTGTCTTTTTGG + Intronic
1114310093 14:21458643-21458665 ATTGCTAAAGATTGTTTTTTTGG + Intergenic
1114731616 14:24999216-24999238 ACGCCTAAGGGTGGTTTTTTGGG - Intronic
1114869412 14:26638125-26638147 ATTGCTATGGTTTGTTTGATAGG + Intergenic
1115021620 14:28687739-28687761 TTTGCTGAGGATTGTTTTATAGG + Intergenic
1115142237 14:30185330-30185352 GTGGCAAAGGGGTGTTTTACAGG - Intronic
1118424810 14:65649226-65649248 AAAGCTTAGGGCTGTTTTATTGG - Intronic
1119938701 14:78617430-78617452 ATGGCTGGGGCTGGTTTTATAGG + Intronic
1120019591 14:79513395-79513417 ATGGCAAAGGGTGGTTTAGTGGG - Intronic
1121949648 14:98160319-98160341 ATGGGAAAAGGTTTTTTTATGGG + Intergenic
1123661977 15:22572497-22572519 ATAGTTGAGGGTTGTTTTAATGG + Intergenic
1123889203 15:24758596-24758618 TTTGCTAAGGTGTGTTTTATGGG + Intergenic
1124262240 15:28203048-28203070 ATAGTTGAGGGTTGTTTTAATGG - Intronic
1124315774 15:28666740-28666762 ATAGTTGAGGGTTGTTTTAATGG + Intergenic
1126200749 15:45983172-45983194 ATGGCTAGTGGTTATTGTATGGG + Intergenic
1126546543 15:49880362-49880384 TTGCCTTAGGGTTGTTTCATGGG - Intronic
1126733084 15:51704450-51704472 ATGGAAAAGTGTTGTTTAATTGG - Intronic
1128356771 15:66933647-66933669 ATGGGGAATGGTTGTTTGATGGG - Intergenic
1128930577 15:71701584-71701606 ATGGCTAAAGAGTGTTTCATAGG - Intronic
1131773177 15:95763387-95763409 ATGGCTCAGGTTTGTTTAAAAGG - Intergenic
1131844539 15:96474941-96474963 ATGGCTATGAGTTTTTCTATAGG + Intergenic
1131874334 15:96788587-96788609 ATGTCTTAGGGATGTTTTAGTGG - Intergenic
1133558645 16:6929255-6929277 ATTGCTAAGGGTTGGATTAGAGG + Intronic
1133598744 16:7318611-7318633 ATGTCTAAGAGTTTGTTTATAGG - Intronic
1133836565 16:9372961-9372983 ACTGCTGAGGGATGTTTTATAGG + Intergenic
1136265382 16:29114378-29114400 GTGGCTCTAGGTTGTTTTATTGG + Intergenic
1137251080 16:46741399-46741421 ATGGCTCTGGGCTGTTTTATGGG - Intronic
1141254739 16:82390520-82390542 ATGGAGAAGTGCTGTTTTATAGG + Intergenic
1142054190 16:87982312-87982334 GTGGCTCTAGGTTGTTTTATTGG + Intronic
1142188149 16:88704406-88704428 ATGGCAGAGGGGAGTTTTATAGG + Intronic
1142524300 17:528218-528240 ATGGGTAAGGGTTTCTTTCTGGG - Intronic
1147838703 17:43354846-43354868 ATTTCTAAGTGATGTTTTATAGG + Intergenic
1149851193 17:60035836-60035858 TTTGTTAAGGTTTGTTTTATGGG + Intergenic
1150539847 17:66086248-66086270 ATGCACAAGAGTTGTTTTATAGG + Intronic
1150586894 17:66526972-66526994 CTGCCCAAGGCTTGTTTTATTGG + Intronic
1154194758 18:12257460-12257482 ACGGCTCAGGTTTGTTTTACTGG + Intronic
1155364405 18:25035928-25035950 ATGGCTGCGGGTTGTGTTTTTGG + Intergenic
1155566779 18:27144285-27144307 TTGCCTAAGAGGTGTTTTATGGG + Intronic
1157955458 18:52092487-52092509 TTGGCTAACAGTTGTTTGATTGG - Intergenic
1158284664 18:55866350-55866372 TTGGCAAAGGCTTGTTTTTTGGG - Intergenic
1158734314 18:60062457-60062479 ATGGCTTAGAGATGTATTATTGG + Intergenic
1160263666 18:77319646-77319668 GTGGCTCAGGGTTTTTTTTTGGG + Intergenic
1164979596 19:32603858-32603880 ATGGAGAAGGTTTGTTTTGTTGG - Intronic
928687596 2:33764931-33764953 ATATCTGAGGGTGGTTTTATAGG - Intergenic
929324087 2:40585048-40585070 ATGGCTATGGGATTTTTTAGGGG - Intronic
931881215 2:66573485-66573507 ATTGCTAAGGGCCGGTTTATAGG - Exonic
934605555 2:95692584-95692606 ATGGATAAGGGATGTTTTGGGGG - Intergenic
936539020 2:113335124-113335146 ATGGATAAGGGATGTTTTCGGGG - Intergenic
943107499 2:183564419-183564441 ATGGATAAGGCTTCCTTTATGGG - Intergenic
943631252 2:190254865-190254887 ATGGCTAGTGGCTGTCTTATTGG - Intronic
945976343 2:216274037-216274059 CTGGTTAATGGGTGTTTTATTGG + Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947952597 2:234161044-234161066 ATGGCTAAGGGATGGATTGTTGG + Intergenic
948863358 2:240763521-240763543 GTGGCCAAGGGTGGATTTATGGG - Intronic
1172598678 20:36168494-36168516 ACGTCTCAGGCTTGTTTTATTGG + Intronic
1174848106 20:53963675-53963697 ATCGCTAAGGGTTTTTTGAGCGG - Intronic
1176990096 21:15485213-15485235 ATAGGTATGGGTTGTTTTAATGG - Intergenic
1177234424 21:18368562-18368584 ATGGCAAAGGGTTGTGCTCTAGG - Intronic
1177466391 21:21487118-21487140 ATGTCTAAGGTTTTATTTATTGG - Intronic
1177998003 21:28127028-28127050 ATGGCAAAAGTTTGTTTAATGGG - Intergenic
1178022209 21:28421968-28421990 TTGGCTCATGGTTGTTTGATGGG - Intergenic
1181184335 22:21091695-21091717 ATGGCTAAGTGTTTTATTCTGGG + Intergenic
1183325817 22:37193125-37193147 ATGGCTAATGGCAGTTTTGTGGG - Intronic
950892917 3:16420772-16420794 ATGGCTAATGGCTGTGTTACAGG + Intronic
951098606 3:18660542-18660564 GTGACTAATGGTTATTTTATTGG + Intergenic
952723138 3:36554480-36554502 TGGGCTAAGGGTTTTTTTGTGGG + Intergenic
952772469 3:37014660-37014682 ATGGCAAAGTTTGGTTTTATTGG + Intronic
960231598 3:115234595-115234617 TTGGCTTTGGGATGTTTTATGGG - Intergenic
960477485 3:118146566-118146588 TGGGAAAAGGGTTGTTTTATAGG + Intergenic
960855659 3:122099696-122099718 ATGGCTAGTGGTTATTATATTGG - Intronic
960933451 3:122878497-122878519 ATGGCTGAGGATTGTCTTGTTGG + Intronic
961229189 3:125286626-125286648 ATATTTAATGGTTGTTTTATTGG - Intronic
962286040 3:134086238-134086260 ATGACTCAAGGTTGTTTTCTGGG - Intronic
963816803 3:149839751-149839773 ATAGCTAAGGATTTTTTTAAAGG + Intronic
964384294 3:156130866-156130888 ATAGCAAAGGGTTGTGTCATAGG + Intronic
964634193 3:158842666-158842688 ATGGCTCAGATTTGTTTTCTTGG - Intergenic
965098179 3:164260799-164260821 CTGGGTAAGGGATGTTTAATGGG + Intergenic
971045595 4:22801763-22801785 TTGACTAAGGGTTGTTATTTGGG - Intergenic
971062216 4:22985105-22985127 ATGGCTGGGGTTTATTTTATGGG + Intergenic
971792776 4:31190102-31190124 GTGGTCCAGGGTTGTTTTATAGG - Intergenic
973035092 4:45396516-45396538 ATGGCTAATGGTTATTATAAGGG - Intergenic
973581368 4:52347603-52347625 ATTTCTAAGTGATGTTTTATAGG + Intergenic
973797641 4:54444623-54444645 ATGCCTAAGGGCAGTTTCATAGG - Intergenic
976748043 4:88425804-88425826 ATTGCTGAGGCTTGTTTTCTAGG + Intronic
979727013 4:123974361-123974383 TTGGCTATGGGTTGCTTTGTAGG + Intergenic
980509289 4:133763555-133763577 CTGGCTAAGTGTTGTATTTTTGG - Intergenic
980589888 4:134872192-134872214 ATGGGTAATGCTTGTTTGATAGG - Intergenic
982360612 4:154515274-154515296 GTGGCTAATGGTTGCTATATTGG - Intergenic
983835967 4:172384905-172384927 CTGGCTAAGGTTTGTTGTGTTGG + Intronic
984097047 4:175446935-175446957 ATTTCTAAGTGATGTTTTATAGG + Intergenic
984767008 4:183407326-183407348 AAGACAAAGGGTTGTTTTACAGG - Intergenic
985483626 5:136023-136045 ATGGCTAAGTGATGTTCTACAGG + Intergenic
988628515 5:32902606-32902628 GTGGTTAAGGGTTGTCTTAATGG + Intergenic
989214443 5:38890149-38890171 ATTGTTGAGGTTTGTTTTATGGG + Intronic
990055732 5:51575825-51575847 ATGTCTAAGAGTTGTTTTGATGG - Intergenic
991161039 5:63503298-63503320 TTTGCTAAGGATTGTTTTATGGG + Intergenic
991309218 5:65216460-65216482 ATGGATATGGGTTTTTTTCTGGG + Intronic
992481228 5:77154232-77154254 ATGGCTGATGGTTTCTTTATGGG + Intergenic
993572408 5:89557772-89557794 ATGGCCAGAGGTTGTTATATTGG - Intergenic
994346008 5:98687251-98687273 ATGGCTAATTTTTGTATTATTGG - Intergenic
996550300 5:124723337-124723359 ATGGCTAAGGGGTTTTGTATTGG + Intronic
996747597 5:126858506-126858528 ATTGCTATTGGTTGTTTTCTGGG - Intergenic
996928457 5:128857566-128857588 ATGGCTCTCGGTTGTTTCATGGG + Intronic
999961184 5:156757316-156757338 ATATCCAAGTGTTGTTTTATTGG - Intronic
1000340825 5:160275914-160275936 ATGCCTATGGGTTGGATTATGGG - Intronic
1000624425 5:163523008-163523030 ATGCCTAAGGGTTGGGGTATGGG + Intergenic
1001222028 5:169908883-169908905 ATGCCTCAGGGTTGTTTTGAAGG - Intronic
1002852961 6:1012603-1012625 ATGGCTAAGGTTTCTTCTTTGGG - Intergenic
1004798656 6:19118880-19118902 ATGGCGAATGATTCTTTTATGGG - Intergenic
1005171892 6:22996297-22996319 CTGGCTAAGGTTTATTTCATTGG - Intergenic
1009548348 6:65052097-65052119 TTGGGTAAGGGTTGCCTTATTGG + Intronic
1011145593 6:84211686-84211708 AATGCTAAGCTTTGTTTTATGGG - Intronic
1012253298 6:97004017-97004039 AATGCTATTGGTTGTTTTATAGG + Intronic
1014323030 6:119955653-119955675 AATGCTAAAGGTTGTGTTATGGG - Intergenic
1017271706 6:152514780-152514802 GTGCCTCAGGGTTGTTTTCTGGG - Intronic
1017273050 6:152531631-152531653 ATGGCTAGTTGTTGTTTAATGGG - Intronic
1017952994 6:159152858-159152880 ATGGTTACAGGATGTTTTATAGG + Intergenic
1021498372 7:21301626-21301648 ATCCCAAAGTGTTGTTTTATAGG + Intergenic
1021548984 7:21849779-21849801 ATGACTAAGAGTTGATTTTTTGG + Intronic
1022243327 7:28533608-28533630 AAGGCTAAGGGTTATTTTTACGG + Intronic
1024853373 7:53746867-53746889 ATTGCTGAGGATTGCTTTATGGG - Intergenic
1024943551 7:54786080-54786102 ATGGCTAAGGGCAGTTTGGTTGG - Intergenic
1028651225 7:93152448-93152470 ATTTCTAAGTGATGTTTTATAGG - Intergenic
1032137340 7:129291933-129291955 ATGGCTAAGTTTTTTTTTAATGG + Intronic
1033986160 7:147228014-147228036 ATGGCTAAGGATTGGTGTAAAGG + Intronic
1041943914 8:63420916-63420938 ATGGGTTAGGGAAGTTTTATGGG - Intergenic
1042455040 8:68991184-68991206 ATGTTTAAGGATTGTTTTAAAGG + Intergenic
1044162382 8:88935728-88935750 ATGGCCAAGGGTTGTTTGCTTGG + Intergenic
1045175347 8:99717640-99717662 ATGGATATGGGTTTTTTTGTTGG - Intronic
1053527031 9:38840624-38840646 GTGGCCAAGGTTTGTTTTCTGGG + Intergenic
1054199257 9:62065055-62065077 GTGGCCAAGGTTTGTTTTCTGGG + Intergenic
1054639099 9:67523302-67523324 GTGGCCAAGGTTTGTTTTCTGGG - Intergenic
1056710590 9:88989771-88989793 CTGGCTGAGGGTTGTTTTAAGGG - Intergenic
1058581300 9:106461090-106461112 ATTTCTCAGGGTAGTTTTATAGG + Intergenic
1059512562 9:114863085-114863107 AATGCTAAGGGTTGTTTTCTAGG - Intergenic
1060002668 9:119972789-119972811 ATGGCTAAGGGATATTTAGTGGG - Intergenic
1061712223 9:132496458-132496480 ATGGCTAAGGGGCGTTCTTTGGG - Intronic
1186117177 X:6317098-6317120 ATGACACAGGTTTGTTTTATGGG + Intergenic
1186641010 X:11455583-11455605 TTGGCTAAGTCTTGATTTATTGG - Intronic
1188687026 X:33081759-33081781 ATGGCTAATGGTAGTTATACAGG - Intronic
1195830302 X:109050374-109050396 ATGGGTAAAGGTTGTTTTCCTGG - Intergenic
1196493024 X:116290791-116290813 ATTTCTAAGTGATGTTTTATAGG - Intergenic
1197697203 X:129563206-129563228 ATGGCTACTGGTTGTCATATTGG - Intronic
1199733774 X:150664792-150664814 ATGGAAAAGGCTTATTTTATAGG - Intronic
1201306953 Y:12559324-12559346 ATGGGTAGGGGCTGTTTTATAGG + Intergenic
1201382561 Y:13399397-13399419 ATGGCAAAGTATTGATTTATGGG + Intronic
1201473783 Y:14359750-14359772 ATGGGGTGGGGTTGTTTTATAGG + Intergenic
1201480476 Y:14433171-14433193 ATGACATAGGTTTGTTTTATGGG - Intergenic