ID: 906712096

View in Genome Browser
Species Human (GRCh38)
Location 1:47938342-47938364
Sequence CTCCAGAGACAGATAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906712096 Original CRISPR CTCCAGAGACAGATAGAGCT GGG (reversed) Intronic
901403709 1:9032029-9032051 CTCCAGAGCCAGCAGGAGCTAGG - Intergenic
901827047 1:11868993-11869015 ATCCTGACACAGAGAGAGCTGGG - Intergenic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
902761933 1:18586869-18586891 CTTCAGAGTCAGATAGATCTGGG + Intergenic
903988350 1:27246256-27246278 CTACAGAGACAGAAAGAGATGGG - Intronic
904747111 1:32718124-32718146 CTCCAGAGCCAGAAAGGCCTGGG - Intergenic
904786466 1:32986903-32986925 CTTCAGAGTCAGAAAGATCTTGG + Intergenic
905194700 1:36266660-36266682 TTCCAGAGCAAGTTAGAGCTTGG - Intronic
905971085 1:42142945-42142967 ATCCAGGGTCAGATAGGGCTTGG + Intergenic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
907354526 1:53861563-53861585 CTCAAGAGAGAGAGAGAGATTGG + Intronic
907827002 1:58027607-58027629 CTCTAGAGCCAGAAAGACCTGGG + Intronic
908411310 1:63868443-63868465 CTCCAGAGTCTGATAGACCTGGG + Intronic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
910806522 1:91194001-91194023 CTGCAGTGGCAGATTGAGCTGGG - Intergenic
911150143 1:94590535-94590557 ATTCAGAAACAGATAAAGCTGGG + Intergenic
911161239 1:94684842-94684864 CTCCAGAGACTGGTAGAGCTGGG - Intergenic
911707088 1:101026138-101026160 CTCCAGAAACAGGGAGGGCTGGG + Intergenic
911775038 1:101798629-101798651 CTCCAGACTCAGATAGATGTAGG + Intergenic
911929250 1:103880737-103880759 CTCCAGAGAAAAATATAACTTGG - Intergenic
911987009 1:104639845-104639867 CACCAGAGAGAGAGAGAGCAGGG + Intergenic
912557968 1:110529934-110529956 CTCCAGAGACAGAGACAGCCAGG - Intergenic
915176881 1:154023124-154023146 GTTCAGAGCCAGATAAAGCTGGG + Exonic
915536682 1:156540658-156540680 CTCCAGAGGCAGGCAGATCTCGG + Intronic
917480846 1:175410716-175410738 CTCCAGAGAGAGAAAGCTCTAGG - Intronic
918651171 1:186965273-186965295 CTTTGGAGACAAATAGAGCTGGG - Intronic
918962823 1:191302768-191302790 CTCCAGTGGCAGCTACAGCTGGG + Intergenic
919849890 1:201665546-201665568 CTCCAGAGAGAGACTGAGATGGG - Intronic
921033081 1:211351004-211351026 GGCCAGAGACAGAGAGAGCAGGG - Intronic
921253201 1:213316663-213316685 CTACAGAGAAAAATAGAGCAAGG + Intergenic
923120111 1:230981990-230982012 CTATAGAGAAAGATAAAGCTGGG - Intronic
923290399 1:232539703-232539725 CTCCAGAACCAGCTAGAGTTGGG + Intronic
923640164 1:235749431-235749453 CTTCAGAGAGAGAGAGAGATGGG + Intronic
923655154 1:235909523-235909545 ACCAAGAGACAGAGAGAGCTTGG + Intergenic
924246006 1:242085906-242085928 TTCCTGAGACAGATAGACCCTGG + Exonic
1062850530 10:738598-738620 CTCCAGACCCAGATAGAGTGCGG + Intergenic
1062850555 10:738715-738737 CTCCAGACCCAGATAGAGTGCGG + Intergenic
1065608480 10:27446324-27446346 CTCAAGAGACAGCTATAACTAGG - Intergenic
1066311472 10:34201091-34201113 ATCTAGAGACAGACAGAACTGGG + Intronic
1068436024 10:56992095-56992117 CTTTAGAGACAGTTTGAGCTGGG - Intergenic
1068658390 10:59597336-59597358 CAGTAGAGACAGAAAGAGCTAGG + Intergenic
1069004799 10:63305512-63305534 CTCCAGAGAGAGAGAGAGAGAGG - Intronic
1069082678 10:64104992-64105014 CTTCATAGAAAGACAGAGCTTGG + Intergenic
1070259037 10:74835568-74835590 CTGGAGAGACAGAAAGAGTTTGG + Intronic
1070537973 10:77393562-77393584 CCCCTGAGACAGATGGAGCTGGG + Intronic
1071287412 10:84161849-84161871 CTCCAGAGAGAGAGAGAGCAAGG + Intergenic
1071346965 10:84702163-84702185 CTCCAGACAAAGGCAGAGCTTGG - Intergenic
1073976834 10:109111728-109111750 TTCCAGAGCCAGATACACCTAGG + Intergenic
1074238780 10:111614575-111614597 CTTCAAAGGCAGACAGAGCTGGG - Intergenic
1074543552 10:114385501-114385523 CCAGAGAGTCAGATAGAGCTGGG + Intronic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1077125502 11:933746-933768 CCCCAGAGACACAGGGAGCTTGG + Intronic
1077503685 11:2920518-2920540 TGCCTGAGACAGACAGAGCTGGG + Intronic
1078160496 11:8835963-8835985 TTCCTGAGACTGTTAGAGCTAGG - Intronic
1078914278 11:15763685-15763707 ACCCAGTGACAGATAGTGCTAGG + Intergenic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1079453896 11:20620748-20620770 CTTCAAAGCCAGATAGACCTGGG - Intronic
1079892482 11:26074056-26074078 CTCTAGAGACAGATGTAACTTGG + Intergenic
1080458323 11:32434479-32434501 CTCCAAAGCCAGGCAGAGCTAGG - Intronic
1081647697 11:44801379-44801401 CTCCAGAGACAGAGACAGACAGG - Intronic
1083821167 11:65172223-65172245 CTGCAGAGACAGATCGGGGTGGG - Intronic
1084448791 11:69220292-69220314 TTCTAGAGTCAGATAGAGATGGG + Intergenic
1085511455 11:77090356-77090378 CTTGAGAGACAGACCGAGCTTGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085782331 11:79420835-79420857 CTCCAGAGTCAGATAAACCCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086635962 11:89086001-89086023 CTCCAGAGAATTTTAGAGCTAGG - Intergenic
1088246600 11:107824411-107824433 CTCCAGAGTTAGATAAAACTGGG + Intronic
1089172080 11:116519211-116519233 CTAAAAAGACACATAGAGCTAGG + Intergenic
1089754857 11:120679238-120679260 CTCCAGAGGCAGACAGGGCTTGG - Intronic
1089960988 11:122617139-122617161 CTCCAGAATCAGACAGAACTGGG + Intergenic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1092057303 12:5518748-5518770 CTGCAGGGAGAGAAAGAGCTGGG + Intronic
1094329555 12:29276035-29276057 CTTCAGAGGCAGACAGACCTGGG + Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1096677533 12:53233675-53233697 CTCCAGGGATAGGAAGAGCTAGG + Intergenic
1097391732 12:59023384-59023406 CTCCAGAGACACAGAAAGTTTGG - Intergenic
1099534104 12:83824390-83824412 ATCCATAGACAGATAGGGCTTGG - Intergenic
1101202627 12:102452758-102452780 CTTCTGAGCCAGAAAGAGCTGGG + Intronic
1101315767 12:103627474-103627496 CTCTAGAGACACATAAAACTTGG - Intronic
1101794387 12:107959354-107959376 CTCAAAAGTCAGATATAGCTGGG + Intergenic
1101892006 12:108725553-108725575 CTTTAGGGCCAGATAGAGCTGGG - Intronic
1105643902 13:22295960-22295982 CTCTGGAGTCAGATAGATCTGGG - Intergenic
1105923349 13:24984982-24985004 CTCCAGAGACAGAAAGGGCCTGG + Intergenic
1106001117 13:25724291-25724313 CTCCAGAGAAAGATTCAGCCTGG + Intronic
1110567791 13:76973781-76973803 CCCCAGAGAGAGAAAGGGCTAGG - Intergenic
1112237461 13:97649179-97649201 CTCTAGAGAAATATAAAGCTTGG + Intergenic
1113636467 13:111922276-111922298 CCCCAGGGACACAGAGAGCTCGG + Intergenic
1116774693 14:49166239-49166261 TTACAGAGGGAGATAGAGCTTGG + Intergenic
1118592380 14:67411331-67411353 CTCCAGAGCCAGTAATAGCTGGG - Intronic
1118758313 14:68861649-68861671 CTCCAGTGAGTGACAGAGCTAGG - Intergenic
1119767056 14:77196683-77196705 CTTCATAGACTGCTAGAGCTAGG + Intronic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1121518656 14:94570622-94570644 TTCCCGGGACAGTTAGAGCTGGG + Intronic
1121619243 14:95334858-95334880 CTCCAGAGACTGAGAGAGATGGG - Intergenic
1123682987 15:22775866-22775888 CTCCAGAGGCACACAGGGCTGGG - Intronic
1125904536 15:43378878-43378900 CTTTGGAGCCAGATAGAGCTGGG - Intronic
1127638241 15:60891501-60891523 CTCCAGAGAAAGTCAGAGCCAGG + Intronic
1127639280 15:60900473-60900495 CCTCAGAGTCAGATAGAGCTGGG + Intronic
1127864179 15:63018396-63018418 CTTCAGAGTCAGACAGACCTAGG + Intergenic
1128242265 15:66109097-66109119 TGCCAGAGAAAGCTAGAGCTTGG + Intronic
1128698448 15:69786707-69786729 CTCTAGAGTCAAACAGAGCTGGG - Intergenic
1128998444 15:72314038-72314060 CTCCTGAGTCAGAGAGACCTGGG - Intronic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1133844696 16:9443149-9443171 CTTTAGAGTCAGATAGACCTCGG - Intergenic
1136287693 16:29254009-29254031 CTCCAGACACCGATGGTGCTGGG + Intergenic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1136599208 16:31272955-31272977 TCCCAGACACAGATACAGCTAGG - Intronic
1137598079 16:49738021-49738043 CACCCGAGACAGAGAGACCTAGG + Intronic
1138363725 16:56454808-56454830 GTCCAAAGACAGAAAGATCTGGG - Intronic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1138705640 16:58912409-58912431 CTCTAGAGCCAGAGAGACCTGGG + Intergenic
1139224748 16:65223444-65223466 CACCAGAGACAGAAAGACCCCGG + Intergenic
1139340102 16:66262826-66262848 CTCCAGAAACAGATACAGACAGG - Intergenic
1139385983 16:66571472-66571494 CTTTAGAGTCAGATAGACCTGGG - Intronic
1141553339 16:84820707-84820729 CTCTGGAGACAGACAGAGCTGGG - Intronic
1142093316 16:88226637-88226659 CTCCAGACACCGATGGTGCTGGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143599976 17:7938710-7938732 TTCCAGAGCCAGGTAGACCTGGG - Intronic
1144256093 17:13470223-13470245 CTCCAGAGGCACCTAGAGATTGG - Intergenic
1144953222 17:19004868-19004890 CTCGACAGACAGACAGACCTGGG + Intronic
1147535826 17:41322877-41322899 CTTCAGAAACAGACAGATCTGGG - Intergenic
1151535665 17:74737516-74737538 CAGCAGAGACACCTAGAGCTTGG - Intronic
1152678830 17:81655387-81655409 CTCCAGACACAGAGAGGGCCTGG - Intronic
1153650796 18:7238084-7238106 CTCCAGTGGCAGAGAGAGCCAGG - Intergenic
1154482128 18:14841016-14841038 CTTTAGAGAAAGATAGAGCATGG + Intronic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1157202628 18:45672006-45672028 CCCCAGAGATAGATGGAGCACGG + Intronic
1157346150 18:46835929-46835951 CTCCAGAGTCAGAAATACCTGGG + Intronic
1157587479 18:48813971-48813993 AGCCAGAGACAGATAGAGGAAGG + Intronic
1157809410 18:50684042-50684064 CTCCTGAGCCAGAGAGAGCCAGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158501671 18:58008068-58008090 CTGCAGAGACTGAAACAGCTGGG + Intergenic
1158835241 18:61323679-61323701 CAACAGAGGCAGTTAGAGCTAGG - Intergenic
1159483857 18:69027891-69027913 CTCCAGAGACAGATCCAATTGGG + Intronic
1159857127 18:73602293-73602315 CTTCAGAGACAGCCAGAGCTAGG + Intergenic
1161502116 19:4622108-4622130 GTCCAGAGACTGGTAGACCTTGG + Intergenic
1162624189 19:11871088-11871110 CTCCACACACAGACAGGGCTTGG - Intronic
1162634046 19:11952648-11952670 CTCCACACACAGATAGGGTTTGG - Intronic
1163732246 19:18955777-18955799 CTCCAGCGACAGATATATCTGGG + Intergenic
1163827771 19:19533176-19533198 CTCCAGAGCCAGACACACCTGGG - Intronic
1166310887 19:41962006-41962028 CTCCACCGAAAGACAGAGCTTGG + Intergenic
1167676139 19:50887275-50887297 CTCGAGAGAGAGAGAGAGATGGG + Intergenic
1167686793 19:50961619-50961641 TTACAGAGACAGATAGAGACAGG - Intronic
925419696 2:3702486-3702508 CTCAGGAGGCAGATGGAGCTGGG - Exonic
926002503 2:9345159-9345181 TTCCAGAGACAAAGAGAGCTGGG - Intronic
926096725 2:10086069-10086091 AGCCAGAGACAGCCAGAGCTGGG + Exonic
926556598 2:14364932-14364954 CCCCAGAGAGAGAGAGAGCCAGG - Intergenic
926609184 2:14928862-14928884 CTCTAGAGTCACCTAGAGCTTGG - Intergenic
927212063 2:20645114-20645136 CTAAAGAGACAGATACAGATGGG - Intronic
927694757 2:25232208-25232230 CTCCTGGGACTGGTAGAGCTGGG - Exonic
927928269 2:27027616-27027638 CTCACGTGACAGAGAGAGCTGGG + Intergenic
927937790 2:27085286-27085308 ATCCAGAGACAGGTAGTCCTGGG + Exonic
927944331 2:27125983-27126005 CTCTAGAGTCAGACAGACCTGGG + Intronic
928794107 2:34995775-34995797 CTTCAGAAAAAGAAAGAGCTGGG + Intergenic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
929802660 2:45117507-45117529 TTCCAGAGACAGATACTGCTTGG - Intergenic
932480254 2:72034881-72034903 TGCCAGAGACAGGTGGAGCTGGG + Intergenic
932489871 2:72113871-72113893 TTCCAGAGACAGGGACAGCTGGG - Intergenic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
933877304 2:86632070-86632092 CTCGAGTGCCAGATAGAGCTCGG - Intronic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
934652290 2:96099524-96099546 CTCTGGAGGCAGATAGACCTGGG + Intergenic
934662979 2:96153008-96153030 CACCACAGCCAGAGAGAGCTGGG + Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935528002 2:104196322-104196344 TTCCAGAGACAGAAAAAGTTTGG - Intergenic
936560329 2:113532885-113532907 CTCCTGAGACATATATAGGTAGG - Intergenic
937035690 2:118779816-118779838 TTCAGGAGTCAGATAGAGCTGGG + Intergenic
938694556 2:133823453-133823475 CTTCAGTGACACATGGAGCTGGG - Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
940373540 2:152928042-152928064 CTCCAGAGATCAATAGACCTAGG - Intergenic
941748388 2:169110813-169110835 AACCAGAGAGAGATAGGGCTGGG + Intergenic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
944185381 2:196942345-196942367 CTCTAGAGTCAGACAGAACTGGG + Intergenic
946439699 2:219684980-219685002 CACCACAGACAGAGAGATCTGGG + Intergenic
946797209 2:223368177-223368199 CTACAGAGTCAGACAGATCTGGG - Intergenic
947817120 2:233045076-233045098 CTCCAGAGACAGGCTGAGCAGGG - Intergenic
948303858 2:236932163-236932185 GACCAGAGAAAGAAAGAGCTGGG + Intergenic
1168873424 20:1151470-1151492 CACAAGAGAAAGCTAGAGCTTGG + Intronic
1168884470 20:1237321-1237343 CTCTGGAGTCAGAGAGAGCTGGG + Intronic
1169017428 20:2303352-2303374 CCACAGAGACAGAAAGAGTTGGG + Intronic
1169164278 20:3408295-3408317 CTGCAGAAACCGGTAGAGCTAGG - Intergenic
1169251424 20:4064124-4064146 ATCCAGAAACAGAGAGGGCTTGG + Intergenic
1170291559 20:14775702-14775724 CTCTAGAGACAGGCAGACCTAGG - Intronic
1170420617 20:16189423-16189445 ATCCAGAGAAAGGCAGAGCTAGG - Intergenic
1170601375 20:17843894-17843916 CTCCAGAGTCAGGTAGCGATGGG + Intergenic
1170644268 20:18182741-18182763 CACCAGAGACACAATGAGCTTGG - Intronic
1172184651 20:33023764-33023786 CTCCAGGGACAGACAGAACCTGG - Intergenic
1172210880 20:33197703-33197725 CTTCAGAGACAGACAGACCTGGG - Intergenic
1174847227 20:53954367-53954389 CTCCAGGAACAGCTAGATCTAGG - Intronic
1175598953 20:60257216-60257238 CTCCAGAGTCAGACAGACCTGGG - Intergenic
1175717692 20:61266327-61266349 CTCCAGAGACAAAGAGAGCTAGG - Intronic
1176798478 21:13395608-13395630 CTTTAGAGAAAGATAGAGCATGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180101322 21:45588496-45588518 CTACAGAGAGAGAAAGAGATGGG - Intergenic
1180609690 22:17087104-17087126 CTCCAGAGATAGACAGCTCTGGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182951447 22:34380073-34380095 ATCATGAGACAGATGGAGCTTGG - Intergenic
1183354941 22:37353204-37353226 CCGCAGAACCAGATAGAGCTGGG - Intergenic
1184942785 22:47781314-47781336 CACCAGGGACAGGGAGAGCTCGG - Intergenic
1185145398 22:49132274-49132296 TTCCAGAGACTGGTAGAGCCAGG - Intergenic
1185182233 22:49370018-49370040 CTCCAGAGGCAAGTAGAGCCTGG + Intergenic
1185189806 22:49427952-49427974 GTTGAGAGACAGAAAGAGCTTGG - Intronic
949416794 3:3823734-3823756 CTCAAGAGGCAGACAGAGCTGGG - Intronic
950306202 3:11916931-11916953 CTCAGGAGAAAGATCGAGCTGGG + Intergenic
950580433 3:13858425-13858447 CTCCAGAGACTGAGAGACCCAGG - Intronic
951041087 3:17989459-17989481 ATCCAGAGAAAGAGAGAGGTGGG - Intronic
951341179 3:21489357-21489379 GTCCATAGACAGAGAAAGCTGGG + Intronic
954673042 3:52300874-52300896 CTCCAGAGACAGAGACAGATAGG - Intergenic
955894309 3:63683130-63683152 ATCCAGAGAGAGTTAGAGGTAGG - Intergenic
956758129 3:72410296-72410318 CTCCAGGGATGGATAGAGATAGG + Intronic
957360404 3:79149460-79149482 AACCAGAGACAGATATTGCTAGG - Intronic
960312655 3:116135434-116135456 CTCCAGAGCCAGACAAAACTGGG - Intronic
960340401 3:116468067-116468089 CTCCAGTGACAGATAGTGGAAGG + Intronic
961034379 3:123632226-123632248 TCACAGAGACAGAGAGAGCTGGG - Intronic
961420632 3:126800389-126800411 ATCCAGAGACAGCTGGAACTCGG + Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962714073 3:138112259-138112281 CTCTGGAGTCAGATAGAACTTGG - Intronic
963309395 3:143691968-143691990 CTCCAGAGGCAAATAGTGATTGG - Intronic
965678207 3:171222153-171222175 CTTCAGATTCAGAGAGAGCTGGG - Intronic
966937281 3:184719251-184719273 CTCCAGAGACATAAAGGGCCTGG + Intergenic
970424385 4:15932976-15932998 CTTCAGAGGCAGAAAGGGCTTGG + Intergenic
970711090 4:18863410-18863432 CTCCATAGTCATAGAGAGCTAGG - Intergenic
972703366 4:41515725-41515747 CTCCAGAGACAGAAAGACCTGGG - Intronic
974667949 4:64989805-64989827 CTTCAGAGTCAGATAGACCTGGG - Intergenic
975299221 4:72770093-72770115 CTGCTGAGACAGAAAGAGATAGG + Intergenic
977274627 4:94961178-94961200 CTCCTGAACCAGATACAGCTGGG - Intronic
977661987 4:99599367-99599389 CTCCAGAGTCAGAAAAACCTAGG + Intronic
978147742 4:105396441-105396463 CTCCAGAGTCAGGCAAAGCTTGG + Intronic
983294263 4:165845865-165845887 CTCCAGAGACAGAAGGATTTTGG - Intergenic
983678832 4:170328977-170328999 GTCCAGAGACAGAAGGAGATAGG + Intergenic
986352484 5:6893483-6893505 CTCTGGAGTCAGATAGAACTGGG + Intergenic
986416026 5:7529154-7529176 GTCCAGGGAGAGACAGAGCTGGG + Intronic
987243853 5:16028517-16028539 CTCCAGAGTCAGACAGTCCTGGG - Intergenic
987756487 5:22103269-22103291 CTCCTAAGACAGACAGAGCCAGG - Intronic
988784475 5:34553408-34553430 CTCCAGAGACAGTCACAGCAAGG + Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
992379916 5:76226965-76226987 GACCAGAGAGAGAAAGAGCTTGG + Intronic
995817571 5:116189135-116189157 CTCCTGTGACAGCTAGAGTTTGG + Intronic
996416805 5:123219582-123219604 CTTCAGAGCCAGATAGACTTGGG + Intergenic
996483654 5:124004290-124004312 CTCTAGAGGCAGAAAGAGCTTGG - Intergenic
999506109 5:152198214-152198236 CTCTGGAGACAGGGAGAGCTGGG - Intergenic
999767428 5:154752175-154752197 CAGCAGAGCCAGACAGAGCTAGG - Intronic
1000191636 5:158916640-158916662 CTTCAGAGATAGAGAGACCTGGG - Intronic
1000300010 5:159947935-159947957 ATCCAGGGACAGCTGGAGCTTGG - Intronic
1001407315 5:171485232-171485254 CTCCAGAGGCAAAGAGACCTGGG - Intergenic
1002406165 5:179033985-179034007 ATCCAGACACAGATAAATCTAGG + Exonic
1002875782 6:1207706-1207728 CTCCAGAGTTACATAGAGGTCGG - Intergenic
1003891101 6:10564477-10564499 CTCCAGAGTCAGAGAGAACCAGG + Intronic
1004477344 6:15986163-15986185 CTCCAGAGACAGGCAGACTTGGG + Intergenic
1004545314 6:16592647-16592669 CTCCAGACACAGAATCAGCTAGG - Intronic
1005970534 6:30757569-30757591 CCCCAAAGACAAAAAGAGCTAGG - Intergenic
1007075290 6:39062304-39062326 CTCCCAAGTCAGATAAAGCTGGG + Intronic
1007586611 6:42994354-42994376 CTCCAGAGTCACACAGACCTGGG - Intronic
1007782870 6:44264290-44264312 CTCCAGACCCAGATGGAGTTTGG - Intronic
1011723294 6:90181887-90181909 CTGCAGAGTCAGAGAGACCTAGG - Intronic
1012283169 6:97354471-97354493 TTCCAGAGATCAATAGAGCTAGG + Intergenic
1012418276 6:99033750-99033772 ATCAAGAGACAGAGAGAGCGAGG - Intergenic
1014254133 6:119144553-119144575 CTCCTGAGACTGACAGTGCTAGG + Intronic
1017768260 6:157624634-157624656 GTTAGGAGACAGATAGAGCTGGG + Intronic
1017819508 6:158039137-158039159 CTCCAGAGACAGAAAGCGAGGGG - Intronic
1021836726 7:24684055-24684077 CTCTAAAGACAGAAAGACCTAGG - Intronic
1022955914 7:35379889-35379911 CTCCAGAAACAGGGAGAGCTGGG + Intergenic
1023561908 7:41483556-41483578 CTCCAGAGAGAGAGACAGTTTGG - Intergenic
1023851012 7:44150402-44150424 CTACAGAGACAGAGAGGGCCAGG - Intronic
1024565342 7:50675766-50675788 CTCCAGAGAAACAGAGACCTAGG + Intronic
1026621533 7:71953881-71953903 CTTCATAGACAGGGAGAGCTAGG + Intronic
1027242812 7:76344005-76344027 TTGCAGAGAAAGATAGATCTCGG - Intronic
1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG + Intergenic
1028409443 7:90512476-90512498 CTCCAAGGAGAGACAGAGCTTGG + Intronic
1029034447 7:97504032-97504054 CTCCAGTGACAGGTAGGGCTCGG + Intergenic
1029259739 7:99293657-99293679 CTGCAGTGACAAATAGAGCCAGG - Intergenic
1029471974 7:100760351-100760373 GGCAAGAGACAGACAGAGCTGGG - Intronic
1031769864 7:125829840-125829862 CTCCAAAGACAGAAAGATGTGGG - Intergenic
1032451825 7:132038108-132038130 CTCCAGAGCCAGAAACAGCAGGG - Intergenic
1032507771 7:132448832-132448854 CTCTAGAGACAACTAGAACTGGG - Intronic
1033233980 7:139623780-139623802 CTCCAGAGTCAGAGGGGGCTGGG - Intronic
1034111661 7:148543161-148543183 CTCCAGAGAGCGTTAGGGCTGGG - Intergenic
1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG + Exonic
1037603746 8:20420513-20420535 CAATAGAGACAGATAGAGATAGG - Intergenic
1037848198 8:22303501-22303523 CTCCAGAGACTGAGGGAGGTGGG - Intronic
1038734554 8:30156849-30156871 CTCCAGAGACAGGAAGGGCCTGG - Intronic
1039414933 8:37385760-37385782 ATCCAGAGAGAGAGGGAGCTGGG + Intergenic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041334035 8:56759601-56759623 GTCCATAGACTGATAGAGCCTGG - Intergenic
1041618773 8:59939600-59939622 CTCTAGAGACAGACAGATATGGG - Intergenic
1044268866 8:90216157-90216179 CTCCAGAGCATGAAAGAGCTAGG - Intergenic
1044938906 8:97320444-97320466 CTCCAAATATAGAGAGAGCTAGG - Intergenic
1044939095 8:97322214-97322236 CTCCAGAGGCAGACAGAGGTAGG + Intergenic
1046139122 8:110066587-110066609 CTCAAAAGAAAGACAGAGCTCGG - Intergenic
1046593632 8:116235194-116235216 ATCCAGAGAGAGAAAGAGCAAGG + Intergenic
1046718971 8:117597488-117597510 CTCCAGAGAAGGATAAAGCTAGG - Intergenic
1047283186 8:123463793-123463815 CCCCAGAGACCTCTAGAGCTGGG + Intronic
1047570345 8:126091276-126091298 CTTCAGAGCCAGATAGACTTAGG - Intergenic
1049369851 8:142259084-142259106 CTTCAGAGTCAGACAGACCTGGG - Intronic
1049377285 8:142295286-142295308 CTCCAGAGACAGATGGCACTTGG + Intronic
1049892349 9:82462-82484 CTCCTGAGACATATATAGGTAGG + Intergenic
1050510165 9:6385924-6385946 CTAAAGAGACAGATAGACCCAGG + Intergenic
1050819682 9:9862675-9862697 CTTCAGAGACAGGCAGAACTTGG - Intronic
1051068320 9:13131822-13131844 CTCCAAAGACTGAGGGAGCTGGG - Intronic
1052025440 9:23568766-23568788 CTCCAGATACAGAAATAGCATGG - Intergenic
1054694641 9:68348013-68348035 CTCCTGAGACATATATAGGTAGG - Intronic
1059207371 9:112479487-112479509 CTCCAGTGGCAGAAAGAGCAAGG - Intronic
1059382374 9:113936192-113936214 CTCCAGAGGCAGACAGACCTGGG + Intronic
1060207095 9:121688537-121688559 CTCTGGAGACAGAGAGAGATGGG - Intronic
1060450548 9:123734589-123734611 CTTCAGAGTCAAACAGAGCTAGG + Intronic
1061439504 9:130590944-130590966 CTCCAGAGTCAGGCAGACCTGGG + Intronic
1061901090 9:133672469-133672491 CTTCTGAAACAGATAAAGCTGGG - Intronic
1062585916 9:137249975-137249997 CTCCAGACACAGATAGGGGCAGG - Intergenic
1186768372 X:12793071-12793093 CTCTGGAGAAGGATAGAGCTAGG + Intronic
1188363314 X:29283580-29283602 CTTCGCAGACAGATAGAGCATGG + Intronic
1189996974 X:46648210-46648232 CTCCACAGAAAGTTAGAGCTGGG + Intronic
1190286310 X:48963579-48963601 CTCTAGAGTCAGATAGTCCTGGG + Intronic
1194407815 X:93519511-93519533 CTCTAGAGTCAGGCAGAGCTAGG - Intergenic
1194820043 X:98494272-98494294 CTCTAGAGTCAGACAGACCTGGG + Intergenic
1196687284 X:118522335-118522357 CTCCAGAGTTAAATAGAGCCTGG + Intronic
1196995561 X:121379210-121379232 CTCCAGAAACACATAAATCTTGG + Intergenic
1197434369 X:126407564-126407586 CTCCAGAGAGAGAAAGAATTGGG + Intergenic
1198036689 X:132808014-132808036 CTGCAGAGACACATCTAGCTTGG - Intronic
1198152267 X:133922703-133922725 CTCCAGGGACAGAAACAGTTTGG + Intronic