ID: 906713293

View in Genome Browser
Species Human (GRCh38)
Location 1:47948731-47948753
Sequence CTGAGGTTAAGGAGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 752}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906713293 Original CRISPR CTGAGGTTAAGGAGAGAGAA AGG (reversed) Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900792396 1:4689118-4689140 CTGAGGTCATGTAGAGGGAATGG + Intronic
901295194 1:8155991-8156013 GGGAGGCTAAGGTGAGAGAATGG - Intergenic
901818278 1:11807351-11807373 TTGGGGTTAAGGTGAGAAAAGGG - Intronic
901860347 1:12070353-12070375 GGGAGGCTAAGGCGAGAGAATGG - Intronic
902284729 1:15400074-15400096 CTGAGCTCCAGGAGTGAGAAAGG - Intronic
902320548 1:15661278-15661300 CTGAGGTTACAGTGACAGAACGG - Exonic
902984682 1:20148407-20148429 CTGAGGTTTGAGAGAGAGAGCGG + Exonic
903023989 1:20413897-20413919 CTCAGGCTAAGGCCAGAGAAGGG + Intergenic
903130899 1:21279068-21279090 CTGAGGCTAAGGAGGGAGCCAGG - Intronic
903163521 1:21505826-21505848 CAGAGATAAAGGAGAAAGAAAGG - Intergenic
903230678 1:21920606-21920628 CTGAGGTTGCAGAGAGAGTACGG - Intronic
903298819 1:22363493-22363515 CTGAGGCTAAGGCAACAGAAAGG + Intergenic
903401961 1:23060145-23060167 CTGAGCAGAATGAGAGAGAAAGG + Intronic
903561118 1:24228626-24228648 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
903930359 1:26858439-26858461 CAGAATTTATGGAGAGAGAATGG - Intergenic
904202486 1:28830097-28830119 CTGAGGAGAGGGAGAGAGATGGG + Intronic
904206860 1:28861187-28861209 TTGAGGCTAAGAAGTGAGAAGGG - Intronic
904417299 1:30371194-30371216 CTGAGGCTCAGGAGACAGAGGGG + Intergenic
904629825 1:31832521-31832543 CTGATATTAAGAAGAGAGGAAGG - Intergenic
904910717 1:33932237-33932259 CTGAAGCTCAGGACAGAGAATGG + Intronic
905060177 1:35133390-35133412 CTGAGGTGAAGGAGAAAAACTGG + Intergenic
905184305 1:36185277-36185299 CGGAGGCTGAGGAAAGAGAATGG + Intergenic
905435297 1:37951531-37951553 CAGAGGTGAAGGAGAGTGGAGGG - Intergenic
905859392 1:41339522-41339544 ATCATGTTAAGTAGAGAGAAAGG - Intergenic
906252476 1:44321353-44321375 CTGAGGCAGAGGGGAGAGAAGGG + Intronic
906690480 1:47789601-47789623 CAGAGGAAGAGGAGAGAGAAGGG - Intronic
906700626 1:47855316-47855338 CTGGGATTAAGGAGAGGAAAGGG - Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
907178588 1:52549868-52549890 ATGAGTTGAGGGAGAGAGAAGGG - Intronic
907353840 1:53855853-53855875 CTGAGGTTCCAGGGAGAGAAGGG + Intronic
907589704 1:55654530-55654552 ATGAGGAGAAGGAGAGAGAGGGG + Intergenic
907648488 1:56268744-56268766 CTGAGGTTAAATAATGAGAAGGG + Intergenic
907652367 1:56307565-56307587 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
907686790 1:56619672-56619694 CTGAGTTTAAGGGGAGTGAAGGG - Intronic
907802480 1:57783894-57783916 CTGAAGAGAAGGAGAGAGATTGG - Intronic
907963772 1:59309438-59309460 TTGAGGTTAGGGAGAGAGGCAGG + Intronic
909045582 1:70705925-70705947 TTGAAATTAAGGAGAGAAAAAGG - Intergenic
909139667 1:71847651-71847673 CTAAGGAGAAGGAGAGAGACTGG - Intronic
909292325 1:73899470-73899492 CTGATGATAAGAAGAGAAAAGGG - Intergenic
909449738 1:75785121-75785143 CTGAGGTTGAGGCAGGAGAATGG - Intronic
909482888 1:76144265-76144287 CTGAGGCCAAGGAAAGAGGATGG + Intronic
911387868 1:97199741-97199763 CAGATGTAAAGGAGGGAGAAGGG - Intronic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
913213271 1:116599306-116599328 ATGAGGTTAAGTAAAGAAAAGGG + Intronic
913307579 1:117449138-117449160 CCAAGGAGAAGGAGAGAGAAGGG - Intronic
913316304 1:117556068-117556090 CTGAGGTTGAGGAAAAAGGAAGG - Intergenic
914667796 1:149846014-149846036 CTGGAGTTTAGGAAAGAGAAGGG + Intronic
915091909 1:153432350-153432372 CTGAGGTTCACAAGAGATAATGG + Intergenic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915554403 1:156653328-156653350 CGGAGGTTGAGGGGTGAGAAGGG - Intronic
915838939 1:159200225-159200247 ATGAGGTTAAACAGACAGAAAGG - Intronic
915895921 1:159810594-159810616 CTGAGCTCAATGAGAGAGAGAGG - Intronic
915996601 1:160570318-160570340 TGGAAGATAAGGAGAGAGAATGG + Intronic
916030682 1:160875243-160875265 CTGTGTTTCAGGATAGAGAATGG + Intergenic
916191587 1:162184159-162184181 CTGAGGAGAGGGAGAGAGATGGG + Intronic
916390615 1:164326746-164326768 ATGAGGAGAAAGAGAGAGAAGGG - Intergenic
916800204 1:168208718-168208740 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
917439285 1:175052559-175052581 TGGAGGGCAAGGAGAGAGAAGGG + Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918124005 1:181566606-181566628 TTGAGGTTAAGGTGAGATGAAGG + Intronic
918426987 1:184420621-184420643 CAGAGGTAAAGTAGAGAGACTGG - Intronic
918498363 1:185165103-185165125 CTGAGGAGAGGGAGAGAGACTGG + Intronic
918637999 1:186802773-186802795 TTGAGGTTCAGTAAAGAGAATGG - Intergenic
919008656 1:191930896-191930918 CAAAGGTTAAGGATAAAGAAAGG + Intergenic
919436051 1:197562634-197562656 CTGAGGAGAGGGAGAGAGATGGG - Intronic
919512633 1:198485179-198485201 TGGATGTGAAGGAGAGAGAAAGG + Intergenic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
920086293 1:203420036-203420058 ACAAGGTTAAGGAGAGAAAAAGG + Intergenic
920635814 1:207702333-207702355 CTGAAGAGAGGGAGAGAGAAGGG - Intronic
921225995 1:213019870-213019892 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
921278683 1:213544294-213544316 GTGAGGTCAAGGATAGAGTAAGG + Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
921479249 1:215644936-215644958 GAAAGATTAAGGAGAGAGAAGGG + Intronic
921540001 1:216402491-216402513 CTGAGGAGGAGGAGAAAGAAGGG - Intronic
922049993 1:221979571-221979593 GTTAGGTTAGGGAGAGAGAGAGG - Intergenic
922091015 1:222395141-222395163 CTGAGGTGAAAGAGAAAGATAGG - Intergenic
922711186 1:227834185-227834207 CTGACGTTAAGGTGTCAGAAGGG - Intronic
923023915 1:230189205-230189227 CTGAGGCTTAGGAGAGACGAGGG + Intronic
923344710 1:233040577-233040599 ATGGGGTTAGGGTGAGAGAATGG - Intronic
923507915 1:234622248-234622270 CTGAGCTCAAGGAGAAAGACAGG + Intergenic
923819201 1:237417290-237417312 CTGAGGCTAAGGAATGATAAAGG - Intronic
924129196 1:240888391-240888413 CTGCGTTTAAGGGGAGAAAATGG + Intronic
924427662 1:243967918-243967940 CTGAGGTTAAAAATATAGAAAGG + Intergenic
924444086 1:244112467-244112489 ATGACATGAAGGAGAGAGAAAGG + Intergenic
924661835 1:246026707-246026729 CTGAGGAGAGGGAGAGAGACAGG - Intronic
1062890229 10:1053937-1053959 CTGAGCAGAAGGAGAGAGATAGG + Intronic
1063317551 10:5021110-5021132 CTGAGGCTACGGAGAGAACAGGG - Intronic
1063412980 10:5851048-5851070 CGGAGGCTGAGGCGAGAGAATGG - Intergenic
1063550573 10:7029039-7029061 ATGAAGCTAGGGAGAGAGAACGG + Intergenic
1064081734 10:12313367-12313389 ATGAGATGAAGGAGAGAGAGGGG - Intergenic
1064128007 10:12681115-12681137 CGGAGTTTTAGGAGAGAAAATGG - Intronic
1064777290 10:18792978-18793000 GGGAGGCTAAGGAGGGAGAATGG - Intergenic
1064865429 10:19873522-19873544 CAAAGGTAGAGGAGAGAGAATGG - Intronic
1065126404 10:22578418-22578440 ATGGGGTTCAGGAGAGAGAAAGG - Intronic
1065285185 10:24180810-24180832 CTGAGGTTAAAGAGACAAAAGGG - Intronic
1065845629 10:29740496-29740518 CTGAGGCCAAGGCGAGAGACCGG + Intergenic
1066265071 10:33768804-33768826 CAGAGGCTAAGGTGAGAGGATGG + Intergenic
1066374676 10:34846918-34846940 CCGAGGAGAAGGAGAGAGACAGG - Intergenic
1066632600 10:37471519-37471541 ATGAGATGAAGGAGAGAGAGGGG - Intergenic
1067119725 10:43463927-43463949 CAGAGGAAAGGGAGAGAGAAAGG - Intronic
1067279344 10:44859547-44859569 CTGAGGCCACGCAGAGAGAAGGG + Intergenic
1067486559 10:46656076-46656098 CTGAAGTTTGGGAGAGAGATTGG - Intergenic
1067608192 10:47685582-47685604 CTGAAGTTTGGGAGAGAGATTGG + Intergenic
1068439818 10:57037765-57037787 AAGAGCTTAGGGAGAGAGAAAGG - Intergenic
1068794738 10:61067136-61067158 CTGACGTCGATGAGAGAGAAGGG + Intergenic
1069202468 10:65638140-65638162 CAGAGGTTGAGGAGAGAAAAGGG - Intergenic
1069248324 10:66236873-66236895 AGGAGGTCAAGGAGAGAGGACGG + Intronic
1069448770 10:68499084-68499106 CTGAGATAGAGGAGAAAGAATGG + Intronic
1069779402 10:70945360-70945382 CTGAGGTTCAGATGAGAAAACGG + Intergenic
1069820808 10:71226659-71226681 ATGATGTTAAAAAGAGAGAATGG - Intronic
1070237663 10:74646494-74646516 CTGTAGTTAAAGAGAGAAAATGG + Intronic
1070246599 10:74738201-74738223 CTGAGGTCAAGGGCAGAGTAGGG - Intergenic
1071028595 10:81144559-81144581 CTAGGGCCAAGGAGAGAGAAAGG - Intergenic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071132740 10:82414279-82414301 CTGAGAAGAGGGAGAGAGAAAGG + Intronic
1071623777 10:87147227-87147249 CTGAAGTTTGGGAGAGAGATTGG + Intronic
1071772920 10:88750166-88750188 GTGAGGTTGTGGAGAAAGAATGG + Intronic
1071851653 10:89577742-89577764 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1071856114 10:89626091-89626113 CAGGGGTTAAGGAGAGGAAATGG + Intronic
1072001286 10:91198238-91198260 CTGAGGTCAGGGAGACAGGATGG - Intronic
1072923096 10:99593243-99593265 CTGAAGATAAAGAGAAAGAAAGG + Intergenic
1073296098 10:102439745-102439767 CTGAGGCTAAGGCAGGAGAATGG + Intergenic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073662488 10:105491997-105492019 CTGAGGTTACAGAGATATAATGG + Intergenic
1073772292 10:106748479-106748501 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1074125611 10:110526548-110526570 CAGAGGCTGAGGCGAGAGAATGG - Intergenic
1074436950 10:113442351-113442373 CTGAGGTAGTGGAGAGAGAAAGG - Intergenic
1074452757 10:113572557-113572579 CTGACATTTAGGAGAGACAATGG - Intronic
1074691462 10:116008720-116008742 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1075082747 10:119394864-119394886 CTCAGGTTTAGGAGAGCGACAGG + Intronic
1075190935 10:120308025-120308047 CTGAATTTAAGCAGTGAGAAAGG - Intergenic
1075570902 10:123544235-123544257 CTGAAGGAAAGGAGAAAGAAAGG - Intergenic
1076642545 10:131928601-131928623 CTGAGGCTTAGGAGAGGAAATGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077347306 11:2068835-2068857 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078305781 11:10184829-10184851 GGGAGGTTGAGGTGAGAGAATGG - Intronic
1078314110 11:10277865-10277887 CTGAAGTTAAGGTGACAGGAGGG - Intronic
1078943131 11:16031797-16031819 AGGAGGTTAGGGAGGGAGAAAGG + Intronic
1078995879 11:16698751-16698773 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1079220329 11:18555048-18555070 GGGAGGCCAAGGAGAGAGAACGG + Intronic
1079303680 11:19303420-19303442 CTGAGGAGACGGAGAGAGATGGG + Intergenic
1079671716 11:23179143-23179165 CTGAGTTTAAGAAGGAAGAATGG - Intergenic
1079717156 11:23763031-23763053 AAGAGGTGAAAGAGAGAGAAAGG - Intergenic
1079961225 11:26926722-26926744 CTCAGGTCAAGGATAAAGAAAGG - Intergenic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1080714274 11:34783662-34783684 CTGAAGTTGAGAAGAGAGAAGGG - Intergenic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1083044041 11:59716300-59716322 ATGAGGTTTAGAAAAGAGAAGGG + Intronic
1084109310 11:67003106-67003128 CTCAGGGGAAGGACAGAGAAAGG + Intergenic
1084369230 11:68728014-68728036 CTGAGGACAGGGAGAGAGACAGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085090605 11:73710061-73710083 CGGAGGTTGAGGCGGGAGAATGG - Intronic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085304318 11:75476609-75476631 CTGAGGCAAAGGAGAGGGAAGGG - Intronic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1086318608 11:85620299-85620321 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1087984525 11:104660808-104660830 TGGGGGTTCAGGAGAGAGAATGG + Intergenic
1088970891 11:114773860-114773882 CTGAGAATCAGGAGAGTGAATGG - Intergenic
1089558844 11:119333236-119333258 CTGAGAGCAGGGAGAGAGAAAGG + Intergenic
1090016898 11:123094209-123094231 ATGAGGCTAAGGTGGGAGAATGG - Intronic
1090397981 11:126431763-126431785 CTGAGGTAAAGGGCAGAGGAAGG + Intronic
1090663239 11:128896443-128896465 CAGAGGTTAAGGAGAGGGTGGGG - Intronic
1090813107 11:130265102-130265124 CTGAGGAGGAGGAGAGAGATGGG - Intronic
1090922993 11:131223544-131223566 CTGGGGTGAAGAAGAGAGAAAGG - Intergenic
1091110064 11:132957868-132957890 CTGAGGAGAAGGAGAGAGACTGG - Intronic
1092103958 12:5907823-5907845 CTTAGGGTATGGAGAGTGAAGGG - Intronic
1092258607 12:6940624-6940646 CTGAGGGGAAGGACAGAGAGAGG - Intronic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1092656696 12:10692561-10692583 CTGAGTTTTGGGAGAGACAAGGG - Intergenic
1092686539 12:11054990-11055012 CGGAGGTTGAGGCAAGAGAATGG - Intronic
1092693470 12:11142670-11142692 CTAAGGTCAAGGATAAAGAAAGG + Intronic
1092703433 12:11258083-11258105 TTAAGGGTAAGCAGAGAGAAAGG + Intergenic
1093154815 12:15669375-15669397 ATGAGGTTAAGGTAAAAGAATGG - Exonic
1093230635 12:16538193-16538215 CTGTGTTTTAGCAGAGAGAATGG - Intronic
1093903112 12:24659519-24659541 CAAAGGTCAAGGAGAAAGAAAGG - Intergenic
1094280111 12:28727559-28727581 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
1094280686 12:28734271-28734293 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1094573510 12:31662853-31662875 CTGAATTAAAGGAGAGCGAAAGG - Intronic
1095557061 12:43520146-43520168 GAGAGGTAAAAGAGAGAGAATGG + Intronic
1095850645 12:46800154-46800176 AGGAGGTGAAGGATAGAGAATGG - Intronic
1095904176 12:47360529-47360551 CTGAGAGTAAGGAAAGAGAAGGG + Intergenic
1096428601 12:51524679-51524701 CTCAGGCTAAGGAGACAGGAAGG - Intergenic
1096432136 12:51554724-51554746 CTGAGGAAAGGGAGAGAGATGGG + Intergenic
1096440326 12:51637204-51637226 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1097058255 12:56263639-56263661 CTGAGGTTGAGGCAGGAGAATGG - Intergenic
1097123668 12:56755564-56755586 CTGAGGAGAGGGAGAGAGAGAGG + Intronic
1097508326 12:60504765-60504787 CAGGGGTAAAGGTGAGAGAATGG + Intergenic
1097587379 12:61530868-61530890 GAGAGGAGAAGGAGAGAGAAGGG - Intergenic
1097922826 12:65095035-65095057 CAGAGGTTGAGGTGAGAGGATGG - Intronic
1097956211 12:65487955-65487977 AAGAGGGTAGGGAGAGAGAAAGG - Intronic
1098142694 12:67467490-67467512 CAAAGGTTAAGGATAAAGAAAGG - Intergenic
1098575796 12:72040762-72040784 TTGAGGATAGGGAGAGAGATGGG + Intronic
1098959217 12:76720819-76720841 CAAAGGTCAAGGAGAAAGAAAGG + Intergenic
1100106838 12:91185612-91185634 GTGATGTCAATGAGAGAGAATGG - Intergenic
1100469994 12:94882376-94882398 AGGAGGTGAAGGAGAGTGAAAGG + Intergenic
1100678722 12:96895588-96895610 CTGAGGCTGAGGCAAGAGAATGG + Intergenic
1100740705 12:97588742-97588764 CAGAAGGAAAGGAGAGAGAACGG + Intergenic
1100876617 12:98968628-98968650 AGGAGCTTTAGGAGAGAGAAAGG - Intronic
1101311948 12:103588960-103588982 CTCAGGTGCAGGAAAGAGAAAGG + Intronic
1101828222 12:108237255-108237277 CAGAGGTTTGGAAGAGAGAAGGG + Intronic
1101844473 12:108351474-108351496 GTGATGTTGAGGAGAGAGAAAGG + Intergenic
1102394417 12:112574745-112574767 GTGTGGTGGAGGAGAGAGAAGGG + Intronic
1102430940 12:112882293-112882315 GTGAGCTTGAGGGGAGAGAAGGG - Intronic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1104087237 12:125486878-125486900 CTGAAGTTAAGGAGATTGAGTGG + Intronic
1104326701 12:127805581-127805603 AAGAGGATAAGGAGTGAGAAAGG + Intergenic
1104750230 12:131233688-131233710 CTGAGCCCAAGGAGAGTGAAGGG + Intergenic
1104782484 12:131430773-131430795 CTGAGCCCAAGGAGAGTGAAGGG - Intergenic
1105216518 13:18289908-18289930 ATGAGGTTAAGTAAAGAAAAGGG + Intergenic
1105589642 13:21779465-21779487 CTGAGAAGAAGGAGAGAGATTGG - Intergenic
1105780060 13:23697763-23697785 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1105847437 13:24305656-24305678 GTAAGGTTAAAAAGAGAGAAAGG - Exonic
1105978407 13:25494079-25494101 GAGAGTTTGAGGAGAGAGAACGG + Intronic
1106929613 13:34650346-34650368 AGGAGGCTGAGGAGAGAGAATGG - Intergenic
1107265087 13:38544403-38544425 GTTAGGATAAAGAGAGAGAAAGG + Intergenic
1107323003 13:39209483-39209505 CTGCACTTTAGGAGAGAGAAAGG + Intergenic
1107783699 13:43932971-43932993 CTAAAGTTCAGGAGAGAGATTGG - Intergenic
1108380199 13:49847674-49847696 GTGGGGTTCCGGAGAGAGAAGGG + Intergenic
1108973474 13:56404857-56404879 CTGAGGTGAAGGATAAAAAAAGG + Intergenic
1109398573 13:61793647-61793669 CTGAGGTCTAGGAGTGACAATGG - Intergenic
1109449183 13:62486448-62486470 TTTAGCATAAGGAGAGAGAAAGG - Intergenic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1109893460 13:68650913-68650935 CTGAGGAGAGGGAGAGAGACGGG - Intergenic
1110766495 13:79285149-79285171 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1111303168 13:86371574-86371596 CAAAGGTTAAGGATAAAGAAAGG - Intergenic
1111376488 13:87385409-87385431 CACATGTTAAGGAGAGAGAACGG + Intergenic
1111640517 13:90963853-90963875 CCGAGGAGAAGGAGAGAGATGGG - Intergenic
1112137126 13:96592860-96592882 CAAAGGTCAAGGATAGAGAAAGG - Intronic
1112245332 13:97728330-97728352 CCGAGGGGAAGGAGAGAGAGAGG - Intergenic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1112472656 13:99702898-99702920 TGGAGGTGAAGGAGAGACAAAGG + Intronic
1112525306 13:100140964-100140986 CTGAGGTTACTGGGAGAGAAAGG + Intronic
1112992034 13:105525640-105525662 TTGAGGTAGAGGTGAGAGAAGGG - Intergenic
1113002710 13:105660945-105660967 ATAAAGTTAAGGAGAGAAAAGGG - Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114646404 14:24258885-24258907 CTAAGGGAAAGGAGGGAGAAGGG - Intronic
1114782412 14:25552925-25552947 CTCAGAGGAAGGAGAGAGAAAGG - Intergenic
1114967649 14:27983169-27983191 AAGAGGTAAAGGAGATAGAAGGG - Intergenic
1114989989 14:28274473-28274495 CTGAGCTTAGGGAGAGACAGAGG - Intergenic
1115468594 14:33744319-33744341 CTGAGGAGAGGGAGAGAGACTGG + Intronic
1115485343 14:33905362-33905384 ATGAGGCAAAGGAGAAAGAAGGG + Intergenic
1116674615 14:47889622-47889644 CTGAGTGTAAACAGAGAGAATGG - Intergenic
1117519542 14:56537095-56537117 CTGAGGAGAGGGAGAGAGACAGG - Intronic
1117912245 14:60647535-60647557 GTGAGGATAAGGGGAAAGAAAGG - Intronic
1118405277 14:65416886-65416908 CAGAGGCTAAGGCGGGAGAATGG - Intronic
1118547358 14:66906286-66906308 CTGAGGATAGGCAGAGACAAAGG - Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118945122 14:70378142-70378164 CTCACCTTAAGGAGAAAGAAAGG - Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1119406143 14:74400970-74400992 CGGAGGTTAATGAGGGAAAATGG + Intergenic
1120066572 14:80047909-80047931 CTGAGGTGAAGGGCAGAGATCGG + Intergenic
1120611914 14:86652089-86652111 GTGAGGGGAAGGAGAGAGATTGG + Intergenic
1120650422 14:87125424-87125446 CTGAGGAAAAGTAGAGATAAAGG - Intergenic
1121009084 14:90509445-90509467 CTGGGGTCCAGGAGGGAGAAAGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121831319 14:97054707-97054729 GTAGGGTTAAGGAGAGAAAATGG + Intergenic
1122086748 14:99312901-99312923 ATGGGGTTAGGGAGAGAGTAGGG + Intergenic
1123979530 15:25588264-25588286 CCAAGGTTAAGGAGGGTGAAGGG + Intergenic
1124255398 15:28137670-28137692 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1124470256 15:29977813-29977835 GGGAGGCTGAGGAGAGAGAATGG + Intergenic
1124568912 15:30841952-30841974 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1125100557 15:35907426-35907448 GTGAGGTAGATGAGAGAGAAGGG + Intergenic
1125272488 15:37954267-37954289 CAAAGGTCAAGGATAGAGAAAGG + Intronic
1125614033 15:40993807-40993829 CTGAAGTTCAGGAGAAAGATTGG - Intronic
1125980278 15:43994971-43994993 CAGAAATGAAGGAGAGAGAAAGG - Intronic
1126107569 15:45156763-45156785 CCAAGGTTAAGGAGAAGGAAAGG - Intronic
1126391699 15:48162865-48162887 CTGAGGCGACGGAGAGAGATGGG - Intronic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127493474 15:59486621-59486643 CAGAGGTCAAGGATAAAGAAGGG + Intronic
1128151421 15:65365660-65365682 CAGAGACTAAGGAGAGAGACTGG - Intronic
1128466124 15:67913852-67913874 CAGGGGTTAAGGAAAGAGAATGG + Intergenic
1128922724 15:71627121-71627143 CTGAGGTTACAGAAAGGGAAAGG + Intronic
1129501313 15:76040131-76040153 CAAAGGTTAAGGATAAAGAAAGG + Intronic
1129887022 15:79045669-79045691 CTGAGGCTCAGGTGAGAGATTGG - Intronic
1130129831 15:81130837-81130859 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1130405594 15:83598063-83598085 CTGTGGTTAAGGGGAAATAAGGG + Intronic
1130417857 15:83710921-83710943 CTGAGCTTAAGGGCAAAGAACGG - Intronic
1131342826 15:91618852-91618874 CTGAGGGTAATTAGAGAGAAGGG + Intergenic
1131492527 15:92875276-92875298 CGGAGGCTAAGGCAAGAGAATGG + Intergenic
1131593536 15:93773808-93773830 CTGAGGATAAGGAAAGTGTAGGG - Intergenic
1131627278 15:94134753-94134775 CGGAGGGTCAGGAGAGTGAATGG - Intergenic
1132024477 15:98393094-98393116 CTGAGATGCAGGAAAGAGAAGGG + Intergenic
1132439053 15:101841028-101841050 CAGAGGTAAAGGATAAAGAAAGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1134423157 16:14113146-14113168 GGGAGGTTGAGGTGAGAGAATGG - Intronic
1134532647 16:14996531-14996553 CAGAGATTAAGAATAGAGAAAGG + Intronic
1134887456 16:17806321-17806343 CTTAGTTTAAGGAGAGAGCCAGG - Intergenic
1135277781 16:21128307-21128329 TGGAGGCTAAGGAGAGAGGATGG + Intronic
1136632238 16:31495680-31495702 CTTAGGTTCAGAAGAGACAATGG + Intronic
1137416166 16:48282703-48282725 CAGAGGAGAGGGAGAGAGAAAGG - Intronic
1137428236 16:48397948-48397970 CTGAGGTGAGGAAGAGGGAAGGG + Intronic
1137469044 16:48738192-48738214 CTGAGGTACAGCAGGGAGAAGGG - Intergenic
1137629120 16:49929839-49929861 CTCAGGTCCAGGAGAGGGAATGG + Intergenic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138844767 16:60552618-60552640 CAGAGGTCAAGGATAAAGAAAGG - Intergenic
1139125909 16:64077112-64077134 CTGAGGCAAGGGAGAGAGATGGG - Intergenic
1139863385 16:70044198-70044220 CAGAGATTAAGAATAGAGAAAGG - Intergenic
1140439126 16:74973323-74973345 CTGGGGTGATGGAGAGAGACCGG - Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141069321 16:80939038-80939060 CTGAGGTTGAAGACAAAGAAAGG + Intergenic
1141407076 16:83804163-83804185 CTGGAGTTGAGGAAAGAGAATGG + Intergenic
1143241375 17:5445736-5445758 CGGAGGTAAAGGTGAGAAAAGGG + Intronic
1144300118 17:13915556-13915578 CTGAGGTTGAGGAAAGAACAGGG - Intergenic
1144592566 17:16536795-16536817 CTGAAGTTAGGGAGAGGAAAGGG + Intergenic
1145277729 17:21444528-21444550 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1146123890 17:30217305-30217327 CTGGGGTGAAGGAGAAAGAAAGG + Intronic
1146838185 17:36129163-36129185 CTGAGGAGAAGGGGAGAGATGGG - Intergenic
1147166812 17:38597909-38597931 ATCAGGTTAAGGAGAGAGGTGGG + Intronic
1147174395 17:38644459-38644481 GGGAGGTTGAGGCGAGAGAATGG - Intergenic
1147391470 17:40111922-40111944 CTGGGCTTAGGGAGAGGGAAAGG - Intergenic
1147667285 17:42156641-42156663 CTGGGGTGCAGGGGAGAGAAGGG + Intergenic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148051282 17:44771193-44771215 CTGAGGCTAAGGCATGAGAATGG + Intronic
1148338526 17:46858639-46858661 CTGAGGATCAGGTGAGAGAAGGG - Intronic
1149940918 17:60864893-60864915 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1149962669 17:61129147-61129169 CTGAGGGTATGGAGTAAGAAAGG + Intronic
1150014272 17:61538050-61538072 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1151630813 17:75309622-75309644 GTGGGGTGAAGCAGAGAGAAAGG - Intergenic
1152979432 18:261960-261982 GTAAGGGTAAGGAGAGAGATTGG - Intronic
1153133183 18:1881397-1881419 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1153292801 18:3518220-3518242 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1153416225 18:4849021-4849043 CTGTGCTTTAGGAGAGATAAAGG - Intergenic
1153871729 18:9327342-9327364 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1155327403 18:24678672-24678694 CTGAGGTGAAGAAAAGTGAAGGG + Intergenic
1155407719 18:25507643-25507665 AAAAGGTTAAGGAGAGACAATGG + Intergenic
1155571103 18:27194846-27194868 CTGAGGTTAAAGACATGGAAGGG + Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1157106880 18:44782211-44782233 TCCACGTTAAGGAGAGAGAAAGG + Intronic
1157555142 18:48608604-48608626 TTGAGGATGAGTAGAGAGAAAGG + Intronic
1157751978 18:50187384-50187406 CTGAGGTGATGCAGTGAGAAAGG + Intronic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1159684614 18:71402590-71402612 GTGAGGTTAAGGAGGGAAAGAGG - Intergenic
1160066056 18:75575364-75575386 CTGGGGCCAAGGAGAGTGAAGGG - Intergenic
1160652479 19:238410-238432 TTGAGGTTAAGCAGGAAGAAGGG - Intergenic
1162392499 19:10397997-10398019 CTGAGGTTCAGGAGAGGTGATGG - Intronic
1162573033 19:11483430-11483452 GTGAGATTAAAGAGCGAGAAAGG - Exonic
1162751444 19:12832506-12832528 CTGAGATTAGGGAAGGAGAAAGG - Intronic
1162840044 19:13349603-13349625 CTGAGCTCAAGGGGATAGAATGG - Intronic
1163635115 19:18433954-18433976 GAGAGGTTGAGGAGAGGGAAAGG - Intronic
1163808816 19:19417533-19417555 CTGAGGTCCAGGAGGGTGAATGG - Intronic
1164513767 19:28917507-28917529 CTGAGGATTAGATGAGAGAAAGG - Intergenic
1164848734 19:31461251-31461273 ATGAATGTAAGGAGAGAGAAAGG - Intergenic
1165507024 19:36239737-36239759 CTGCTGTTACAGAGAGAGAATGG + Intronic
1165925194 19:39321809-39321831 TGGAGGAGAAGGAGAGAGAAAGG - Intergenic
1166285875 19:41827981-41828003 CTGAGGATAGGCAGAGACAAGGG - Intergenic
1167123279 19:47531844-47531866 CTGAGATGCAGGAGAGAGAAGGG - Intronic
1167229160 19:48270949-48270971 CGGAGGCTGAGGCGAGAGAATGG + Intronic
1168246821 19:55116779-55116801 CTCAGGTTCAGGAGAGGGCAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925264395 2:2555857-2555879 AAGATGTTAAGGAGAAAGAAAGG - Intergenic
925282583 2:2695159-2695181 CTGAGCTTCAGGAGAGAGCTGGG - Intergenic
926364117 2:12117291-12117313 CTGAGGTCCAGGAAAGGGAATGG + Intergenic
926511334 2:13783773-13783795 CGGAGGCTAAGGCAAGAGAATGG + Intergenic
927489986 2:23514935-23514957 CTGAGATTAAGGACATAGGAGGG - Intronic
927661996 2:25001129-25001151 CCAAGGTAGAGGAGAGAGAAGGG - Intergenic
927998162 2:27501112-27501134 CTGATGGTGAAGAGAGAGAAGGG - Intronic
929420881 2:41788488-41788510 CTTAGAAAAAGGAGAGAGAAGGG - Intergenic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
930017042 2:46978012-46978034 CTCCAGTTAAGGAAAGAGAAGGG - Intronic
930082897 2:47468834-47468856 GTGATGTAAAGGAGAAAGAAAGG - Intronic
930294497 2:49537542-49537564 CAGAGGTAAAGGATAAAGAAAGG + Intergenic
930347705 2:50205940-50205962 CTTGGGAGAAGGAGAGAGAAGGG + Intronic
930489364 2:52048680-52048702 CTGAGGAAAAGAAGAGAGAAAGG + Intergenic
930984262 2:57565814-57565836 TTGAAGTAAAGGACAGAGAAGGG + Intergenic
931279609 2:60777780-60777802 CTGAGGAGAGGGAGAGAGATGGG + Intronic
931615455 2:64151931-64151953 AAGAGGTGAAGGAAAGAGAAAGG + Intergenic
931802485 2:65772184-65772206 CCCAGGGTAAGGAGACAGAAAGG - Intergenic
932074138 2:68647431-68647453 CTGGGTTAAAGGAGAGAGACAGG - Intronic
932457036 2:71856508-71856530 CTTAGGATAAAGGGAGAGAAAGG - Intergenic
932477153 2:72013458-72013480 CTGAGGCTAGGGAGAGACAGAGG + Intergenic
932831632 2:74996076-74996098 CAGAAGTTGAGGAGAGAGGACGG + Intergenic
932858186 2:75260693-75260715 CTGAGCTGGAGGACAGAGAAGGG + Intergenic
932931853 2:76050631-76050653 CTGAGGACAGGCAGAGAGAAAGG - Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933487423 2:82940193-82940215 CTGAGAAGAGGGAGAGAGAAAGG + Intergenic
934061654 2:88299844-88299866 CTGAGGAGAGGGAGAGAGAGAGG - Intergenic
934297811 2:91756816-91756838 ATGAGGTTAAGTAAAGAAAAAGG - Intergenic
934639383 2:96018231-96018253 CGGAGGCTGAGGTGAGAGAATGG + Intergenic
934663325 2:96154511-96154533 TAGAGGAAAAGGAGAGAGAAGGG - Intergenic
934965805 2:98720846-98720868 CAGAAGGAAAGGAGAGAGAAAGG + Intronic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
937108150 2:119338524-119338546 GTGAGGAGAATGAGAGAGAAAGG + Intronic
937317383 2:120940607-120940629 CTGGGGTCACAGAGAGAGAATGG - Intronic
937435625 2:121878604-121878626 GCCAGGTGAAGGAGAGAGAATGG - Intergenic
937564784 2:123271581-123271603 CGGAGGTTGAGGCGGGAGAATGG + Intergenic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
937975387 2:127579207-127579229 CTAAAGGAAAGGAGAGAGAAAGG + Intronic
938108560 2:128549651-128549673 ATGAGCTTCAGGAGAGAGACCGG + Intergenic
938562544 2:132487078-132487100 CTGAGGATAGGGAGAGAGATGGG + Intronic
938577873 2:132620689-132620711 CACTGGTGAAGGAGAGAGAAGGG - Intronic
939428448 2:142071816-142071838 CTGAGGTTTTGGAGAGAGAAGGG - Intronic
939437816 2:142201275-142201297 CTCAGGAGAGGGAGAGAGAAGGG - Intergenic
939486568 2:142819921-142819943 CTGAGGAGAGGGAGAGAGACAGG + Intergenic
939548022 2:143577727-143577749 CTGTGGCTAAGGAAATAGAATGG + Intronic
939707007 2:145467501-145467523 CTGAGTTTAGGCAGAGATAATGG - Intergenic
939759396 2:146155478-146155500 CTGGAGTTAAGCAGTGAGAATGG + Intergenic
939812520 2:146852107-146852129 ATGAGGACAAGGAGAGACAATGG - Intergenic
939830655 2:147066448-147066470 CTGAGGTTAAGGAAAGTGGAAGG - Intergenic
940249331 2:151657197-151657219 CTCAGGATAATAAGAGAGAATGG + Intronic
940296271 2:152128306-152128328 CTGAGGCTGAGGGAAGAGAATGG + Intronic
940725652 2:157333008-157333030 CTGAAATTAATGAGAAAGAAAGG - Intergenic
941063902 2:160879228-160879250 CTGAGCTCAAGGTGGGAGAAGGG - Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941457778 2:165730597-165730619 AGGAGGCTAAGGAGGGAGAATGG + Intergenic
941503760 2:166313959-166313981 CTGAGGAAAGGGAGAGAGATAGG + Intronic
941728473 2:168889931-168889953 CTGAGGTGGAGGAGAGAGACAGG - Intronic
941731528 2:168923052-168923074 CTAAGGCTAAGGATAGGGAAAGG - Exonic
942747788 2:179255106-179255128 CTGAGGAGAAGGAGAGAGACAGG - Intronic
943616561 2:190099372-190099394 CTGAAGAGAAGGAGAGAGACAGG + Intronic
944206126 2:197160593-197160615 ATGAGATTAAGGATAAAGAATGG - Intronic
944995152 2:205285546-205285568 ATGAGGTTGAACAGAGAGAATGG - Intronic
945135550 2:206623953-206623975 CTCAGGGTAAGGACAGAAAAAGG + Intergenic
946901246 2:224374016-224374038 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
947209028 2:227689328-227689350 CAAAGGTTAAGGATAAAGAAAGG + Intronic
947532275 2:230917708-230917730 CAGAGGTTAAGGCAAGAGGATGG + Intronic
947626527 2:231622632-231622654 CTGAGGACAAGCAGAGAGAGTGG - Intergenic
947942414 2:234069743-234069765 CGGGGGAGAAGGAGAGAGAATGG + Intronic
948034377 2:234846479-234846501 CTGGGGTAGAGGAGAGACAATGG + Intergenic
948372115 2:237495990-237496012 TTGAGTTTACGTAGAGAGAATGG - Intronic
1168916931 20:1497167-1497189 CTAAAGCTAAAGAGAGAGAAAGG - Intergenic
1169049048 20:2560730-2560752 CGGAGGCTAAGGTGGGAGAATGG + Intronic
1169451524 20:5716080-5716102 CGGAGGTGAAGGAGGTAGAAGGG + Intergenic
1169653886 20:7900656-7900678 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1169836702 20:9888278-9888300 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1170104130 20:12735583-12735605 CCAAGGTTAAGGAGAGATATAGG - Intergenic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171043228 20:21786235-21786257 CTGAGGACAAGGAGAGGCAAAGG + Intergenic
1172236349 20:33378265-33378287 CTGAGGAAAGGGAGAGAGATGGG + Intronic
1172388189 20:34548398-34548420 TTGAGGTCACGGAGGGAGAAGGG + Intronic
1172438300 20:34946099-34946121 CTGTGATCAAGAAGAGAGAATGG + Intronic
1173079379 20:39851176-39851198 CAGAGGTTAAGGGGAGAGACGGG - Intergenic
1173171240 20:40725737-40725759 CTGTCTTTAAGGAGAAAGAAGGG - Intergenic
1173768228 20:45633199-45633221 CTGAGGAGAGGGAGAGAGATGGG - Intergenic
1173785417 20:45789594-45789616 CTGCAGATAACGAGAGAGAAAGG + Intronic
1173790208 20:45823380-45823402 CTGAGGGAAAGGAGAGGGAGAGG + Intronic
1173910723 20:46668047-46668069 CTGAGGAGAGGGAGAGAGATTGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174734683 20:52954880-52954902 CTGAGGTCAGGGGGATAGAATGG - Intergenic
1175248070 20:57593211-57593233 GTGAGATTAAGAACAGAGAAGGG - Intergenic
1176326773 21:5508297-5508319 CAGAGACTAAGGAGAGAGAGTGG + Intergenic
1176400984 21:6312654-6312676 CAGAGACTAAGGAGAGAGAGTGG - Intergenic
1176436173 21:6676450-6676472 CAGAGACTAAGGAGAGAGAGTGG + Intergenic
1176460435 21:7003520-7003542 CAGAGACTAAGGAGAGAGAGTGG + Intergenic
1176483996 21:7385298-7385320 CAGAGACTAAGGAGAGAGAGTGG + Intergenic
1176946046 21:14982995-14983017 CTGAGGAGAGGGAGAGAGATGGG - Intronic
1177335707 21:19723384-19723406 CTGAGGGCTAGGAGAAAGAAAGG + Intergenic
1177665162 21:24147266-24147288 CTAAGGTCTAGGAGTGAGAAGGG + Intergenic
1178437200 21:32570377-32570399 CTGAGGGGAGGGAGAGAGATGGG - Intergenic
1179455533 21:41497143-41497165 CTGAGGTCAATAAGAGACAAGGG - Intronic
1179841065 21:44074164-44074186 CAGAGCTACAGGAGAGAGAAAGG - Intronic
1180032002 21:45218149-45218171 ATGACGGTGAGGAGAGAGAAGGG - Intronic
1180418002 22:12786692-12786714 CGGAGGTTGAGGAAGGAGAATGG - Intergenic
1181520326 22:23444836-23444858 CTAAGGAGAAGGAGAGAGATGGG + Intergenic
1182103481 22:27673011-27673033 ATGAGGAGAAGGAGAAAGAAAGG + Intergenic
1182569146 22:31223124-31223146 CTGGGGTGAAGGACAGGGAAGGG + Intronic
1183361943 22:37387391-37387413 CTGAAGTGAGGGAGAGAGAAGGG - Intronic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183727308 22:39596901-39596923 CTGAGTGTCAGGAGACAGAAAGG - Intronic
1183759628 22:39804502-39804524 CTGAGGTTAAAGAGGGAAATGGG - Intronic
1184714346 22:46272465-46272487 CTGTGGTAAAGGAAAGAGAGGGG - Intronic
1184925949 22:47637480-47637502 CTCACATGAAGGAGAGAGAAAGG - Intergenic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
949384423 3:3484368-3484390 AGGAGGTTGAGGTGAGAGAATGG - Intergenic
949391732 3:3569914-3569936 CTGAGGGGAGGGAGAGAGACGGG - Intergenic
949518178 3:4826021-4826043 CTTAGGTGCAGGAGAGAGGAAGG + Intronic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
949757980 3:7435790-7435812 CAGAGGCTGAGGAAAGAGAATGG - Intronic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
950210321 3:11118315-11118337 CTGAGGGTAAGGAGAGTCACAGG - Intergenic
951096429 3:18637064-18637086 CAGAGGTTAAGCAGATAGATCGG - Intergenic
951194611 3:19810321-19810343 CTGAGGGAAAGAAGAGGGAAGGG + Intergenic
952003670 3:28815799-28815821 CTGAAGAGAAGGAGAGAGAGGGG + Intergenic
952150661 3:30586479-30586501 GTGAGGTTAAGGGGTGGGAATGG + Intergenic
952809959 3:37393103-37393125 CTGAGGAGAGGGAGAGAGACTGG - Intronic
953174443 3:40537022-40537044 CTGAGGAGAGGGAGAGAGATGGG - Exonic
953483968 3:43277011-43277033 CTGAGGAAAGGGAGAGAGATGGG - Intergenic
953651197 3:44806526-44806548 CTGAGAATGAGGAGAGAGAAAGG + Intronic
954191943 3:48969332-48969354 GTGTGGTTGAGCAGAGAGAAGGG + Intronic
954580271 3:51699503-51699525 CTGAGATGAAGGAGACAGAGTGG + Exonic
955211156 3:56942505-56942527 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955290344 3:57686770-57686792 CTGAGGAGAGGGAGAGAGATGGG - Intronic
955416614 3:58697870-58697892 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
955984320 3:64557166-64557188 CTGAGGTGAAGGTCAGAGGAAGG + Intronic
957319117 3:78606475-78606497 CACAGGTTAAAGAGGGAGAAGGG - Intronic
958044493 3:88266973-88266995 CGGAGGTTGAGGCGGGAGAATGG + Intergenic
958267749 3:91459576-91459598 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
958590829 3:96156075-96156097 GTAAGGGTAATGAGAGAGAAAGG + Intergenic
958995246 3:100896627-100896649 ATAAAGTTATGGAGAGAGAAAGG - Intronic
959721693 3:109498020-109498042 CTGAGGAAAGGGAGAGAGACGGG + Intergenic
960258867 3:115542033-115542055 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
960599427 3:119441101-119441123 CTGACGTGAGGGAGAGAGATGGG - Intronic
960648083 3:119912188-119912210 CTGAGGATAGGAAGAGAGATGGG + Intronic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961802432 3:129462101-129462123 CTGAGGTTCAAAAGAGAGAATGG + Intronic
962167995 3:133070419-133070441 CACAAGTTAAGGGGAGAGAAAGG - Intronic
962953616 3:140244047-140244069 CTGAGGTAAAGTAGAGAGGAAGG + Intronic
963194521 3:142511734-142511756 GTGAGAGTAAGAAGAGAGAAAGG + Intronic
963542759 3:146615187-146615209 CTGAGGATGTGGAGAGAGATGGG - Intergenic
963802450 3:149689473-149689495 CAGAGGTCAAGGATAAAGAAAGG + Intronic
964136367 3:153349237-153349259 CTGAGGGTAAAGAGGCAGAAAGG - Intergenic
964223697 3:154372667-154372689 TGGAGGTCATGGAGAGAGAATGG + Intronic
964810280 3:160655700-160655722 CTAAGGTCAAGGATAAAGAAAGG + Intergenic
965224180 3:165966666-165966688 CTGAGGGGAGGGAGAGAGATGGG - Intergenic
965234209 3:166094093-166094115 CAGAGGTCAAGGATAAAGAAAGG + Intergenic
966087681 3:176089239-176089261 CTGTGTTTTAGGAGAGACAAAGG + Intergenic
967307905 3:188076760-188076782 CGGAGGCTAAGGTGGGAGAATGG - Intergenic
967491847 3:190101140-190101162 CTGAGGACAGGGAGAGAGACAGG - Intronic
968269666 3:197393775-197393797 CTGGGGTTCAGCAGAGAGACAGG + Intergenic
968530051 4:1086794-1086816 ATGGGGTGGAGGAGAGAGAATGG + Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970163771 4:13215066-13215088 TTCAGGTTGAGGATAGAGAAGGG - Intergenic
970528781 4:16960718-16960740 CTAAGGAGAAGGAGAGAAAAGGG - Intergenic
970699344 4:18716150-18716172 CTTAAGTTAAGGCAAGAGAAGGG + Intergenic
970755188 4:19417395-19417417 CTGACGTTGGGAAGAGAGAAAGG + Intergenic
970880167 4:20919373-20919395 ATGAGAGTAAGAAGAGAGAAAGG - Intronic
970950304 4:21747934-21747956 CAGAGGCTAAGGTGAGAGCAAGG + Intronic
971569156 4:28187748-28187770 CTGAGGACAGGGAGAGACAAAGG - Intergenic
971590808 4:28467015-28467037 CGGAGGCTGAGGCGAGAGAATGG + Intergenic
972281726 4:37608135-37608157 CTGAGGAGAGGGAGAGAGACGGG - Intronic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972400323 4:38695917-38695939 CTGAGGTTTGGAAGAGAAAAGGG + Intronic
974337413 4:60568469-60568491 CATAGGTTAAGGACAAAGAAGGG - Intergenic
975673142 4:76801877-76801899 CTGAGAGTAAGCTGAGAGAATGG - Intergenic
975865675 4:78721354-78721376 CTGAGGGGAAGGAAACAGAAAGG - Intergenic
976291806 4:83426347-83426369 CTGAGGGGAAGGAGAAGGAAAGG + Intronic
976362116 4:84192578-84192600 CAGAGGTGAAGGAGAAAGAAGGG - Intergenic
976794542 4:88917667-88917689 CTGAGGTCAAGGATGGAAAATGG - Intronic
976974750 4:91152919-91152941 TTGAGGGCAATGAGAGAGAAAGG - Intronic
977184307 4:93917417-93917439 CAGAGGTTGAGGAGAAGGAAGGG + Intergenic
977427751 4:96890729-96890751 ATGAAGAGAAGGAGAGAGAAAGG - Intergenic
977770587 4:100853213-100853235 TTGAGGTGAAGGAGAGAAAATGG - Intronic
978082897 4:104616368-104616390 CTCTGCTTAAGGAGAGAGGAGGG - Intergenic
978701451 4:111651462-111651484 GGGAAGTGAAGGAGAGAGAAAGG + Intergenic
980184035 4:129439240-129439262 GGGAGGTTAAGGAGAGAAGAAGG - Intergenic
980208876 4:129759080-129759102 CGGAGGTTCAAGAGAGATAAAGG - Intergenic
980318362 4:131235667-131235689 CTAGGGTTCAGAAGAGAGAAAGG + Intergenic
980806475 4:137821272-137821294 CTAATGAGAAGGAGAGAGAAGGG - Intergenic
981493012 4:145361191-145361213 CTGAGGAGAGGGAGAGAGATAGG - Intergenic
982152765 4:152480385-152480407 CTGAGGAGAGGGAGAGAGATAGG - Intronic
982315540 4:154027526-154027548 TAGAGGTTATGCAGAGAGAATGG - Intergenic
982400117 4:154957163-154957185 CAGAAGCTAAGGAGAGAGAGAGG - Intergenic
983464739 4:168073277-168073299 CTGAGGGGAGGGAGAGAGACAGG + Intergenic
983721966 4:170866109-170866131 CTGAGGGCAAGGGGAGAGATTGG - Intergenic
983784180 4:171711546-171711568 ATGAGGGTGAGCAGAGAGAAAGG + Intergenic
983891754 4:173036887-173036909 CTGAGGTGAAGGGCAGAGGAGGG + Intronic
983987405 4:174076269-174076291 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
984462365 4:180054632-180054654 CTGAAGTCAGGGAGAAAGAAGGG - Intergenic
984637137 4:182123518-182123540 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
985311105 4:188600418-188600440 CTGAGGAGAAGGACAGAGATGGG + Intergenic
985330918 4:188832181-188832203 GAGAGGTTATGGAGAGAGAGAGG - Intergenic
986738644 5:10686211-10686233 CTGAAGAGAAGGAGAGAGACAGG - Intronic
987620732 5:20336332-20336354 CTCAGGAGAAGGACAGAGAAAGG + Intronic
987726659 5:21709403-21709425 CTGAGGAGAAGGAAAGAGATGGG - Intergenic
987746098 5:21973993-21974015 CTTAGGTCAAGGAGAGATTATGG + Intronic
987750419 5:22031708-22031730 CAGAGGAGAAGGAGAGAGACAGG + Intronic
987994529 5:25258660-25258682 CTGGTGTTAGGGAGGGAGAAAGG + Intergenic
988655521 5:33207306-33207328 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
988669768 5:33368837-33368859 CTGAGGAGAGGGAGAGAGAAAGG + Intergenic
988939590 5:36129324-36129346 CTGAGGTCAAGGATAAAGAAAGG + Intronic
989125912 5:38052239-38052261 CTGAGGGGTAGGAGGGAGAAAGG + Intergenic
989654107 5:43725909-43725931 CTGAGGAGAAGGCGAGAGATTGG + Intergenic
990481580 5:56216316-56216338 CTGAGGAGAGGGAGAGAGATGGG - Intronic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990788767 5:59453243-59453265 CTGAGGAGAAAGAGAGAGATAGG - Intronic
990902400 5:60766859-60766881 CTGGGGTTAGAGAGGGAGAATGG - Intronic
990932952 5:61113951-61113973 CAAAGGTTAAGGATAAAGAAAGG - Intronic
991224845 5:64258115-64258137 GTGAGGCTGAGAAGAGAGAAAGG + Intronic
991766304 5:69984103-69984125 CTTAGGTCAAGGAGAGATTATGG + Intergenic
991781014 5:70134050-70134072 CTTAGGTCAAGGAGAGATTATGG - Intergenic
991845537 5:70859186-70859208 CTTAGGTCAAGGAGAGATTATGG + Intergenic
991873460 5:71134364-71134386 CTTAGGTCAAGGAGAGATTATGG - Intergenic
992587420 5:78254427-78254449 CAAAGGTCAAGGATAGAGAAAGG + Intronic
993709402 5:91209254-91209276 CTGAGGAGAGGGAGAGAGATAGG + Intergenic
994088771 5:95789681-95789703 GTGAGGAGAAGGAGAGAGAGAGG + Intronic
994237442 5:97380051-97380073 TTTAGGTTAAGAAGAGATAAGGG - Intergenic
994300693 5:98143546-98143568 CCAAGATTAAGGTGAGAGAAGGG + Intergenic
994307626 5:98226105-98226127 CTGAGGATGAGGGGAGAGTAGGG + Intergenic
994591199 5:101774877-101774899 GTCAGGTTAAGGAAAGAGGATGG - Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994759734 5:103837103-103837125 CTGAGGTTAAAAAGAGACAAAGG + Intergenic
995327780 5:110911131-110911153 CAGAGGTAGAGGAGATAGAAAGG + Intergenic
995572959 5:113501270-113501292 CAAAGGTTAAGGATAAAGAAAGG - Intergenic
995847270 5:116507811-116507833 TTCAGGCTAAGGAGAGTGAAAGG - Intronic
995854575 5:116577903-116577925 GGGAGGCTGAGGAGAGAGAATGG - Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
997331781 5:133068696-133068718 CTGAAGCACAGGAGAGAGAAAGG + Intronic
997459750 5:134043916-134043938 GTGAGGATTAGGTGAGAGAATGG - Intergenic
997473197 5:134128175-134128197 CTGGGGTTGAGGAGTGGGAAGGG - Intronic
997566649 5:134892814-134892836 CTGAGGAGAGGGAGAGAGATGGG + Intronic
997598411 5:135122604-135122626 ATGAGGCTAAGCAGAGAGGAAGG - Intronic
997695080 5:135854986-135855008 CTGAGGAGAGGGAGAGAGATAGG + Intronic
998262421 5:140641699-140641721 CAGAGGAAAAGGAGAGAGAGGGG + Exonic
998364166 5:141618405-141618427 GTAAGGTTAAGAAGAGAAAATGG + Intronic
998408561 5:141889300-141889322 TTGAGGTTCTGGAGAGGGAAGGG - Intergenic
998750522 5:145316879-145316901 TTGAGGTAAACGAGGGAGAAAGG - Intergenic
999042982 5:148435896-148435918 CTGAGGAAAGGGAGAGAGACAGG + Intronic
999644820 5:153707300-153707322 CTGAAGCTAAGAAAAGAGAAAGG + Intronic
999978155 5:156932897-156932919 CGGAGGTTGAGGCAAGAGAATGG + Intronic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000373442 5:160558524-160558546 CAGAGGTAAAGGGGAGATAATGG - Intergenic
1000373663 5:160560132-160560154 CAGAGGTAAAGGGGAGATAATGG - Intergenic
1001042737 5:168348537-168348559 CTGAGGTCAAGGTGGGATAAAGG - Intronic
1001110268 5:168890033-168890055 CTGAGGCTAAGGCAGGAGAATGG + Intronic
1001597793 5:172909136-172909158 CTGGGGCTCAGGAAAGAGAAGGG - Intronic
1002254569 5:177949749-177949771 CAGAGGAAAAGGAGAAAGAATGG - Intergenic
1002483422 5:179518063-179518085 CAGAGGAAAAGGAGAAAGAATGG + Intergenic
1002975615 6:2072574-2072596 CTGAAGTTAAGGAAAGATACTGG + Intronic
1003242783 6:4358952-4358974 CTGCGGTGGGGGAGAGAGAAGGG + Intergenic
1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003910473 6:10739516-10739538 CAGAGGCTGAGGCGAGAGAATGG + Intergenic
1004066369 6:12248659-12248681 CTAAGCTTCAGGAGAGTGAAAGG + Intergenic
1004290689 6:14364154-14364176 TTGAGCTGAAGGAGAGAGGAAGG + Intergenic
1004458991 6:15818033-15818055 CTGATGTCCAGGAAAGAGAAGGG + Intergenic
1004645253 6:17554303-17554325 CTGAGGATAGGCAGAGACAATGG + Intronic
1004741383 6:18464571-18464593 CTGAGGTTCAGGTGACAGCATGG + Intronic
1004785809 6:18966076-18966098 AAGAGGTTAAAGAGAGATAAAGG + Intergenic
1005067246 6:21830517-21830539 GAGAGGGAAAGGAGAGAGAAAGG - Intergenic
1005339157 6:24827354-24827376 TTGATGTTCTGGAGAGAGAAGGG + Intronic
1005893082 6:30155832-30155854 CTGAGGCCAAGAAGAGGGAAGGG + Intronic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006337249 6:33427309-33427331 CTCAGGATAAGGAGAAAGATGGG - Intronic
1006977555 6:38117462-38117484 ATGTGGTCAAGAAGAGAGAAAGG - Intronic
1007130009 6:39463227-39463249 GTGAGATAAAGGAGAGAAAATGG - Intronic
1007374710 6:41448599-41448621 ATCAGGGTAAGGCGAGAGAAAGG - Intergenic
1007496113 6:42261123-42261145 CTGAGGCTGAGGCGAGAGAGGGG + Intronic
1008108133 6:47462524-47462546 CTGGCTTTAAGGATAGAGAAAGG + Intergenic
1008620550 6:53267110-53267132 CTCAGGGTAAGGGGAGAGATTGG + Intergenic
1008987465 6:57562008-57562030 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1009175420 6:60454565-60454587 CTGAGGAGAGGGAGAGAGACAGG + Intergenic
1009298290 6:61982564-61982586 CGGAGGCTGAGGCGAGAGAATGG + Intronic
1009726497 6:67542509-67542531 CTGTGCTTTAGGAAAGAGAATGG + Intergenic
1010349539 6:74856487-74856509 CTGAGGTTAAGGTATTAGAAGGG + Intergenic
1010475740 6:76285296-76285318 CAAAGGTTAAGGACAAAGAAAGG - Intergenic
1010568860 6:77453519-77453541 CTGAGGTTAAGGTCACACAACGG + Intergenic
1011293709 6:85805291-85805313 CGGAGGCTGAGGTGAGAGAATGG - Intergenic
1011770261 6:90667872-90667894 TGGAGCTTAAGGAAAGAGAAGGG - Intergenic
1011942327 6:92857658-92857680 CTGAGGTTTAGGAGAAAAAATGG - Intergenic
1012069361 6:94593041-94593063 CTGATAATAGGGAGAGAGAATGG + Intergenic
1012103865 6:95127933-95127955 GTGAGGTTAAAAAGAGGGAAAGG + Intergenic
1012284463 6:97372169-97372191 CTGAAGAGAAGGAGAGAGATGGG - Intergenic
1012347822 6:98213179-98213201 CGGAGGCTGAGGTGAGAGAATGG + Intergenic
1012564889 6:100636428-100636450 CTGAGGAGAAGGAAAGAGATGGG - Intronic
1014319604 6:119910542-119910564 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1014618031 6:123628324-123628346 CTGAGGAGAAGGAGAGATAGTGG + Intronic
1014647485 6:123992194-123992216 ATGATGTTCAAGAGAGAGAAAGG + Intronic
1014671470 6:124309882-124309904 TAAAGGTGAAGGAGAGAGAAGGG - Intronic
1015230464 6:130909435-130909457 ATGAGGTTAAGAAGAAAGAAGGG - Intronic
1015609703 6:135003460-135003482 GAGAGGCTAAGGTGAGAGAATGG + Intronic
1016061365 6:139634651-139634673 CAAAGGTTAAGGATAAAGAAAGG - Intergenic
1016151775 6:140749747-140749769 CAGAGGTCAAGGATAAAGAAAGG + Intergenic
1016627637 6:146191033-146191055 CAGAGGTGAGAGAGAGAGAATGG - Intronic
1016827424 6:148401147-148401169 CGGAGGTTAAGGTGGGAGGATGG + Intronic
1017104167 6:150872460-150872482 CAGAGGAGAGGGAGAGAGAAGGG + Intronic
1017243727 6:152198687-152198709 CAGAGGAGAAGGAGAGAGATTGG + Intronic
1017668639 6:156747819-156747841 GTGAGATTAGGGAGAGAGGAAGG - Intergenic
1017754767 6:157520022-157520044 CTGAGCTGAAGGGAAGAGAAGGG + Intronic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1018758116 6:166867032-166867054 CTGAGGTCAAGGTGTGAGCAGGG - Intronic
1018818264 6:167351976-167351998 CTGAGGGGAGGGAGAGAGATGGG - Intronic
1019590916 7:1831392-1831414 CTAAGGAGAAGGAGAGAGATGGG - Intronic
1019638597 7:2090196-2090218 CTAAGGTGGAGGTGAGAGAAGGG + Intronic
1019941679 7:4297177-4297199 CTGAGTTAAAGGTGAGAGAAGGG - Intergenic
1020615468 7:10454072-10454094 GGGAGGCCAAGGAGAGAGAATGG - Intergenic
1020638614 7:10727750-10727772 CTGAGGTCAAGGAGAGAGCTTGG - Intergenic
1021149840 7:17136161-17136183 CTGAGGTTAGAGATAGGGAAGGG - Intergenic
1021530339 7:21637217-21637239 GGGAGGAGAAGGAGAGAGAAAGG - Intronic
1022384989 7:29891501-29891523 CTGAGTTGAGAGAGAGAGAAAGG + Intronic
1023481741 7:40642433-40642455 CTGAGGGTAAGGAGAAGGAAGGG + Intronic
1023956547 7:44891271-44891293 AAGAGGATGAGGAGAGAGAAAGG + Intergenic
1024277830 7:47693213-47693235 CTAAGGTTACGGAAAGAGACTGG - Intergenic
1024425432 7:49220090-49220112 CTGAGGCTAGGGAGGAAGAAGGG + Intergenic
1024692116 7:51814358-51814380 CTGAGGTTTGGGAGAGAGGCTGG + Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1026203628 7:68236555-68236577 CTGAGATGCAGGAGAGAGGAGGG + Intergenic
1026273657 7:68858203-68858225 CTGAGGTTGAAGAGAAAGAATGG - Intergenic
1026420079 7:70226290-70226312 CTGAGGCTGAGGCAAGAGAATGG - Intronic
1027723539 7:81773596-81773618 CTGAGGGGAGGGAGAGAGACGGG - Intergenic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028178309 7:87683541-87683563 CTGAGGAGAAAGAGAGAGATGGG + Intronic
1028186431 7:87791050-87791072 CAGAGGTCAAGGATAAAGAAAGG + Intronic
1028295053 7:89119066-89119088 CTGAGTTTAATGAAAGAGTAAGG + Intronic
1029452272 7:100647676-100647698 CTGATGGAGAGGAGAGAGAATGG + Intronic
1029913815 7:104184977-104184999 CTGAGGTTACAGAAAGAAAATGG - Intronic
1030711073 7:112749881-112749903 CTGACAATAAGTAGAGAGAATGG + Intergenic
1030826996 7:114170301-114170323 CTGAAGAGAAGGAGAGAGACAGG - Intronic
1030905983 7:115183334-115183356 CTGAGGGGAAGGAAAGAGATAGG - Intergenic
1031120870 7:117720182-117720204 GGGAGGGTAAAGAGAGAGAAGGG - Intronic
1031215202 7:118881569-118881591 CTGAGGTAAGGAAGAGAGAAGGG - Intergenic
1031854732 7:126908120-126908142 CTGGAGCTAAAGAGAGAGAAGGG + Intronic
1031944114 7:127820644-127820666 ATGAGGTTAGAGAGAAAGAAAGG - Intronic
1032138597 7:129306017-129306039 CAAAGGTCAAGGATAGAGAAAGG - Intronic
1032572228 7:133012657-133012679 GGGAGGTTAAGGTGAGAGGATGG + Intronic
1032743931 7:134766885-134766907 CTGAGGTCATGGACAAAGAATGG + Intronic
1033112502 7:138593702-138593724 CTAAGGAAAAGGAGAGAGAAGGG + Intergenic
1033453679 7:141483398-141483420 CTGAGAAGAAGCAGAGAGAAAGG - Intergenic
1033661767 7:143407802-143407824 CTGAGGCTTAGGGGAGAAAAAGG + Intronic
1033731997 7:144189170-144189192 CTGAGGCCAAGGGGAGAGTAAGG - Intronic
1033742846 7:144287753-144287775 CTGAGGCCAAGGGGAGAGTAAGG - Intergenic
1033751056 7:144361861-144361883 CTGAGGCCAAGGGGAGAGTAAGG + Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034094399 7:148393245-148393267 CTTAGCATAAGGAGAGAAAAGGG - Intronic
1034195807 7:149246485-149246507 GGGAGGTTGAGGCGAGAGAATGG - Intronic
1034316060 7:150134381-150134403 CAGTGGTGAAAGAGAGAGAAGGG - Intergenic
1034790828 7:153966400-153966422 CAGTGGTGAAAGAGAGAGAAGGG + Intronic
1035407813 7:158611288-158611310 CTCAAGTTGAGGAGACAGAAAGG + Intergenic
1036108074 8:5863666-5863688 CTGAGGAGATGGAGAGAGACAGG + Intergenic
1036157712 8:6358044-6358066 CAGAGGCTAAGGCGGGAGAATGG - Intergenic
1036220031 8:6913806-6913828 CTGAGGCAAAGGCCAGAGAAAGG + Intergenic
1037249012 8:16871112-16871134 ATGAGGCTAGGGAGAGAGGAAGG + Intergenic
1037948226 8:23002727-23002749 GGGAGGGTTAGGAGAGAGAAGGG + Intronic
1038104458 8:24416751-24416773 CTGAGGTTAAGGAGAAGGGAGGG - Intergenic
1038490695 8:27968686-27968708 ATGAGGCTAAGGAGACAGCAGGG - Intronic
1038869985 8:31483386-31483408 CTGAGGCCCAGGAGAGTGAAGGG + Intergenic
1039373396 8:37009710-37009732 TTGAGGTCAAGGAGTCAGAAGGG - Intergenic
1039729671 8:40260654-40260676 CTGAAGGAAAGTAGAGAGAAGGG + Intergenic
1039786235 8:40836756-40836778 CTTAGGTTGGGGAGACAGAAGGG + Intronic
1039935180 8:42036803-42036825 GTGAGGGTAAGGAGAAAGAAAGG + Intronic
1040036788 8:42878116-42878138 CTGAGGAGAGGGAGAGAGACTGG - Intronic
1040073211 8:43204921-43204943 GGGAGGCTAAGGCGAGAGAATGG - Intergenic
1040396686 8:47007410-47007432 CTCAGGACAAAGAGAGAGAAGGG + Intergenic
1041025930 8:53686994-53687016 CACAGGTTAAGGAAGGAGAATGG + Intergenic
1041165113 8:55084067-55084089 GAGAGGTTAAGGTGAGAGGATGG - Intergenic
1041280083 8:56199890-56199912 ATGAGCAAAAGGAGAGAGAATGG + Intronic
1041357486 8:57015505-57015527 TTGAGATTAAGGAGAGAGGAGGG + Intergenic
1042570167 8:70155356-70155378 CTGATCTTAAAAAGAGAGAAAGG + Intronic
1042723872 8:71851534-71851556 CTTAGATTAAGGAGAGCAAAGGG + Intronic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1043086158 8:75835988-75836010 CAGAGGGTAAAGAGAGAGCATGG + Intergenic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044030890 8:87235507-87235529 CTGAGGACAGGGAGAGAGATGGG + Intronic
1044237919 8:89853565-89853587 CAGAGAGTAAAGAGAGAGAAGGG + Intergenic
1045158338 8:99505485-99505507 CTGAGGTGAGGGAGAAAGATGGG + Intronic
1045967885 8:108046979-108047001 GAAAGGTTAAAGAGAGAGAAAGG + Intronic
1047009897 8:120660882-120660904 CTGAGGAGAGGGAGAGAGATGGG + Intronic
1047321334 8:123786810-123786832 TTAAGTCTAAGGAGAGAGAAGGG + Intronic
1047340038 8:123972196-123972218 TTTAGGTTAGGGAGAGAGAGTGG + Intronic
1047741675 8:127811703-127811725 TTGAGGGGACGGAGAGAGAAAGG - Intergenic
1048161629 8:132026874-132026896 GTGAGGTTGAGGAGACAGACAGG - Intronic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049052458 8:140209437-140209459 CAGATGTTAAGGACAGAGAAGGG - Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050096901 9:2076569-2076591 TGGGGATTAAGGAGAGAGAAGGG - Intronic
1050286710 9:4110453-4110475 CTGAGCTTGAGTAGGGAGAATGG - Intronic
1050369919 9:4910202-4910224 ATGAGGCCAAGGAAAGAGAAAGG + Intergenic
1051009870 9:12398312-12398334 CTGAGGACAAGGAAAGAGATGGG - Intergenic
1051301166 9:15652533-15652555 GGGAGGCTAAGGTGAGAGAATGG - Intronic
1051336425 9:16070319-16070341 CAGAGGTAAAGGACAGAGGAGGG + Intergenic
1051506224 9:17830538-17830560 CTGAGATTTTGGAGGGAGAAAGG - Intergenic
1052466895 9:28840116-28840138 CTGAGCTTGAGGAGACAGAGGGG + Intergenic
1052921339 9:33972510-33972532 CTGAAGTTAGAGAGAGACAAAGG + Intronic
1052952313 9:34222825-34222847 CTGAGCTTAAGAAAAGAAAAAGG + Intronic
1054456451 9:65433861-65433883 CTGAGGTCAAGGTGTGAGCAGGG - Intergenic
1054839411 9:69719969-69719991 CTGGGGTGAGGGAGAGAGATGGG - Intronic
1055150679 9:72995260-72995282 TTGAGGAGAAGGAGAGAGATGGG - Intronic
1055357066 9:75448550-75448572 TTGAGGTTATGAAGGGAGAAAGG + Intergenic
1055534151 9:77219070-77219092 CAGAGGTGAAGGGCAGAGAAAGG + Intronic
1056959622 9:91111583-91111605 CTGAGGAGAAGGAAAGAGATGGG + Intergenic
1058263860 9:102873291-102873313 CAGAGGTAAAGGAGAGAGCAAGG + Intergenic
1058648375 9:107152100-107152122 CAGGAGGTAAGGAGAGAGAAAGG + Intergenic
1059429218 9:114240197-114240219 CTGAGGGGAAGCAGAGAGCAGGG - Intronic
1059882672 9:118709064-118709086 CAGAGGCTGAGGAGAGAGAATGG - Intergenic
1060039560 9:120288086-120288108 CTAAGGTAGAGGAGAGAGAAGGG - Intergenic
1060487250 9:124055651-124055673 GTGAGGTTGAGAAGGGAGAATGG - Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061166469 9:128925605-128925627 CTGAGGCTCTTGAGAGAGAAAGG - Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1062509470 9:136897017-136897039 CTGATGTTGAGGACAGAGGAAGG - Intronic
1185818417 X:3178962-3178984 GGGAGGCTAAGGAGGGAGAATGG + Intergenic
1186085606 X:5987363-5987385 AGGAGGATAAGGAGATAGAATGG + Intronic
1186887727 X:13931381-13931403 CGGAGGCTGAGGCGAGAGAATGG + Intronic
1187063088 X:15806877-15806899 CAGAGGACAAGGAGAGAGAGAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187311024 X:18142878-18142900 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1187537638 X:20157758-20157780 CTCAGGTAGAGTAGAGAGAATGG + Intronic
1187791514 X:22955483-22955505 CGGAGGCTGAGGAAAGAGAATGG + Intergenic
1187839313 X:23470555-23470577 TTGAGGAAAAGGAGAGAGACAGG - Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188733861 X:33687360-33687382 CAGAGGTCAAGGATAAAGAAAGG - Intergenic
1191915582 X:66198193-66198215 CCGAGGTGAGGGAGAGGGAAAGG - Intronic
1192039748 X:67606111-67606133 CTGAGGGAAAAGAGAGATAAGGG + Intronic
1192054670 X:67760868-67760890 GTGAGTTTAACGAAAGAGAATGG + Intergenic
1192229799 X:69257034-69257056 CAGAGGTGAAGGAGAGTGAATGG - Intergenic
1192310843 X:70012958-70012980 CTCAGGCTCAGGAGAGAGCAAGG + Intronic
1192408215 X:70908677-70908699 CGGAGGTTGTGGAGAGAGCAGGG - Exonic
1192806316 X:74512610-74512632 CTGAGTTGAAAGAGAGAGAGGGG - Intronic
1192845009 X:74897535-74897557 TGGAGGGTAAGGAGAGTGAAAGG + Intronic
1192895618 X:75440382-75440404 AGGAGGCTAAGGCGAGAGAATGG - Intronic
1193167560 X:78299714-78299736 CAGAGGTCAAAGATAGAGAAAGG - Intronic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1193711224 X:84882712-84882734 ATGAGGGAAAGGAGAGAGAAGGG + Intergenic
1194305248 X:92237684-92237706 AAGAGGTTAAGGAGAGATAAGGG - Intronic
1194550962 X:95298762-95298784 CAGAGGCTGAGGTGAGAGAATGG - Intergenic
1194580248 X:95663095-95663117 ATGAGGAAAAGGAGAGAGAGAGG - Intergenic
1195401835 X:104469069-104469091 GAGAGGTTATGGACAGAGAAGGG + Intergenic
1196236808 X:113291310-113291332 ATGAGGTCAGGGATAGAGAAAGG + Intergenic
1196357403 X:114810176-114810198 CTCAGCTTGAGGAGAGAAAAGGG - Intronic
1196984362 X:121252242-121252264 CAGAGGTCAAGGATAAAGAAAGG - Intergenic
1197163632 X:123351614-123351636 CTGACTTAAAGGAGAAAGAAGGG - Intronic
1197167415 X:123392879-123392901 ATAAGTTTAAGGAGTGAGAATGG + Intronic
1197338984 X:125243184-125243206 CAGAGGCTAAGGCGGGAGAATGG + Intergenic
1197358585 X:125468602-125468624 CTGAGGTGAAAGAGAGAGATGGG + Intergenic
1197470167 X:126857323-126857345 CTGAAGTCAAGGATAAAGAAAGG + Intergenic
1198113471 X:133522990-133523012 CTGAGATTGGGGAGAGAGAGTGG - Intergenic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198323142 X:135539794-135539816 CTGAGGAGAGGGAGAGAGATAGG + Intronic
1198490593 X:137136394-137136416 CTGAGGAGAGGGAGAGAGATGGG + Intergenic
1199577599 X:149328401-149328423 CTGAGTAGAAGGAGAGAGATGGG - Intergenic
1200177482 X:154126870-154126892 CAAAGGTTAAGGATAAAGAAAGG + Intergenic
1200207628 X:154328820-154328842 CTGAGGTTGATGACAGGGAAAGG + Intronic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200834290 Y:7717922-7717944 CTGAGGTCCAGAAGAGGGAAGGG + Intergenic
1202134316 Y:21646138-21646160 TGGAGGCTAAGGAGGGAGAATGG - Intergenic