ID: 906713555

View in Genome Browser
Species Human (GRCh38)
Location 1:47950932-47950954
Sequence CTCTACTGGAAGCAGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906713555_906713560 -2 Left 906713555 1:47950932-47950954 CCTTGGGCCTGCTTCCAGTAGAG 0: 1
1: 0
2: 2
3: 15
4: 168
Right 906713560 1:47950953-47950975 AGAAGAGGGTTTCATTTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 130
906713555_906713561 -1 Left 906713555 1:47950932-47950954 CCTTGGGCCTGCTTCCAGTAGAG 0: 1
1: 0
2: 2
3: 15
4: 168
Right 906713561 1:47950954-47950976 GAAGAGGGTTTCATTTCCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
906713555_906713563 22 Left 906713555 1:47950932-47950954 CCTTGGGCCTGCTTCCAGTAGAG 0: 1
1: 0
2: 2
3: 15
4: 168
Right 906713563 1:47950977-47950999 CACAGTGCCCCACACAGAGCAGG 0: 1
1: 2
2: 9
3: 136
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906713555 Original CRISPR CTCTACTGGAAGCAGGCCCA AGG (reversed) Intronic
900438009 1:2640655-2640677 CTCTACTGGAGGCTGGCCCAAGG + Intronic
900582014 1:3414099-3414121 CTCTGCTGTGAGCAGGTCCAGGG + Intronic
901028266 1:6290786-6290808 CTCTACAGTTAGCAGGCCTAGGG - Intronic
901091719 1:6646087-6646109 TTTTACTGGGAGCTGGCCCAGGG - Intronic
901276638 1:7996717-7996739 CTGTACTGGAAGCATGGCCCTGG + Intergenic
902243991 1:15107287-15107309 CTGGAGTGGAAGCAGGCCCTGGG - Intronic
903288691 1:22293455-22293477 CTATGCTGTAAGCAGCCCCATGG + Intergenic
904805368 1:33127567-33127589 CTCAGCTGGAAAAAGGCCCAGGG + Intergenic
906713555 1:47950932-47950954 CTCTACTGGAAGCAGGCCCAAGG - Intronic
907247310 1:53116367-53116389 CTTTACTGGAAGCACCTCCAGGG + Intronic
908256034 1:62304480-62304502 CTGGATTGGAAGCAGGTCCAGGG - Intronic
909049843 1:70753972-70753994 TTCTACTTGAAGGAGCCCCATGG - Intergenic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
916393417 1:164358570-164358592 CTGTACTAGAAGCATCCCCAAGG - Intergenic
917336048 1:173925358-173925380 CTGAACTGGAAGCAGGGCTAGGG - Intergenic
919921350 1:202168304-202168326 ATCTCCCGGAAGCATGCCCATGG - Intergenic
920652119 1:207845549-207845571 CACTACAGGAACCAGGGCCAAGG - Intergenic
921278894 1:213545969-213545991 CTCCCCTGTAATCAGGCCCAGGG + Intergenic
922477548 1:225916896-225916918 CTCTCCCTGAAGCAGGACCAGGG + Intronic
1063446393 10:6120643-6120665 ATCTCCTGGGAGTAGGCCCATGG + Intergenic
1064295817 10:14078355-14078377 CTCTCCTGGCAACAGGCTCAAGG + Intronic
1067296787 10:44979226-44979248 CTCTCCTAGGAGCAGGCCTAGGG - Intronic
1069153345 10:64994031-64994053 GTCTCCTGAAAGCAGGCACATGG + Intergenic
1069552467 10:69374229-69374251 TTCTACCTGAAGCAGACCCAGGG + Intronic
1070668728 10:78363267-78363289 CTGTAGTGGAGGCAAGCCCAGGG + Intergenic
1073053029 10:100681415-100681437 CTCCTCCGGAAGCCGGCCCAGGG + Intergenic
1075082549 10:119393554-119393576 CTCTGCAGGACGCAGGCCCTGGG - Intronic
1075658864 10:124179719-124179741 CCCTCCTGGAACCAGGCCCTGGG + Intergenic
1075777736 10:124999098-124999120 CTCTGCTGCAAGCAGGCCTCTGG - Intronic
1076813034 10:132899011-132899033 GTCTACAGGAAGAAGGCCAAGGG - Exonic
1077251541 11:1563016-1563038 TTCCACTGGATGCAGGGCCAAGG + Intronic
1077252410 11:1566484-1566506 CTCCAGTGGAGGCAGCCCCAAGG - Intronic
1080314118 11:30929340-30929362 CTGTACTGGTGGAAGGCCCAGGG + Intronic
1080700082 11:34637288-34637310 CTTTTCTGGAAGCAAGCCCTTGG + Intronic
1083573281 11:63771377-63771399 CTCTACTGCAATCAGTGCCAGGG - Intergenic
1084303932 11:68269491-68269513 CTGTGTTGGGAGCAGGCCCATGG - Intronic
1085651787 11:78274776-78274798 TTGTACTGGAAGCACCCCCAGGG - Intronic
1085925576 11:81015981-81016003 CTCAAGTGGAAGCAGACTCAGGG + Intergenic
1088180589 11:107104572-107104594 CTCTACAGGAAGCATGGCTAGGG + Intergenic
1088588190 11:111378709-111378731 CTCAGCTAGAAACAGGCCCAGGG + Intronic
1089111385 11:116060559-116060581 CTCTACTGGAAGTAGGAACTTGG + Intergenic
1090830231 11:130416109-130416131 CACCAGTGGAAGGAGGCCCACGG + Intronic
1090844609 11:130520314-130520336 CTCCGCTGGAAGCAGCCCAAAGG - Intergenic
1090960318 11:131550601-131550623 CTGTACAGGAAGCATGGCCAAGG - Intronic
1092102625 12:5898742-5898764 CACGACTGGAAGGAGGCCCAAGG + Intronic
1093190269 12:16066119-16066141 CTCTACTGGAGTCAGTCCCTGGG - Intergenic
1096523926 12:52199557-52199579 CTTTCCTGAAAGCAGCCCCAGGG - Intergenic
1096862450 12:54539708-54539730 CTCTACTAGAGGAAGGCTCAAGG - Intronic
1100006486 12:89901290-89901312 CTTTACAGAAATCAGGCCCAAGG + Intergenic
1104611553 12:130232825-130232847 TTCTACTGAAAGCATCCCCATGG - Intergenic
1105212167 13:18263404-18263426 CTCGGGGGGAAGCAGGCCCAGGG - Intergenic
1105997417 13:25685848-25685870 CTCTGCTGGGTGGAGGCCCAGGG + Intronic
1107147083 13:37070532-37070554 CTCTGCTGGTAGCTGGACCATGG + Intergenic
1107869027 13:44730044-44730066 CTCTTCTGGAAGGAGTCCAAGGG - Intergenic
1112236448 13:97642182-97642204 CTCTTCAGGAACCAGGACCAGGG - Intergenic
1114726044 14:24938723-24938745 CCCTCCTGGAAGCAGGCCAGGGG + Intronic
1116943496 14:50813734-50813756 CACTACTGGAAATAGACCCAAGG + Intronic
1120840881 14:89083880-89083902 CTGTACAGGAAGCATGGCCAGGG - Intergenic
1121483041 14:94292961-94292983 CTCTGCAGGAAGGAGGCCAAGGG - Intronic
1121783940 14:96640506-96640528 CTCTCCTGAAAGCTGGGCCATGG - Intergenic
1122621370 14:103059271-103059293 ATCAACTGGAAGGAGGCACAAGG + Intergenic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1134083266 16:11339134-11339156 CTCCACTTCACGCAGGCCCAGGG - Intronic
1135731764 16:24900490-24900512 CTTTCCTGGAAGCAGGACTAGGG - Intronic
1138160864 16:54752933-54752955 CTTTAATGGAAAAAGGCCCAGGG + Intergenic
1140682866 16:77402350-77402372 CTCTTCTGGAAGCAGGCCTAGGG + Intronic
1141005483 16:80348018-80348040 CTGTGGTGGCAGCAGGCCCAGGG + Intergenic
1141934680 16:87229391-87229413 CTTTGCTGGGAGGAGGCCCAGGG - Intronic
1141982555 16:87559493-87559515 CTCTACAGGCAGCTGGTCCAAGG - Intergenic
1143637675 17:8175812-8175834 CTCCACTGCAAAGAGGCCCAGGG + Exonic
1144778004 17:17794536-17794558 CTCTACTGCAACCAGGCCCGTGG + Exonic
1148349712 17:46931721-46931743 CTCTCCTGGAAGAAGCCCAAGGG - Intronic
1150057447 17:62031504-62031526 CTCTTGTGGAAGCAGGCACTTGG + Exonic
1155304390 18:24464815-24464837 TTCTACTGGGAGCAGGGGCATGG + Intronic
1158169970 18:54586489-54586511 ATTTACTGGAAGCATGGCCAGGG - Intergenic
1162028991 19:7909384-7909406 CTGCCCAGGAAGCAGGCCCAGGG - Intronic
1164471629 19:28541204-28541226 CTCAAGTGGAAGCAGCCCCAGGG - Intergenic
1168485785 19:56760880-56760902 CTCAACTGACAGCAGGCCCCAGG + Intergenic
1168516287 19:57012898-57012920 CTGTACTGGATGCTGTCCCACGG + Intergenic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
928235828 2:29538518-29538540 CTGTACTGGAAGCAAGGCAATGG - Intronic
930164479 2:48190862-48190884 CTCTGCTGGAAACTGACCCAGGG - Intergenic
930402154 2:50904015-50904037 CTCTGCTGGAATCAGGGCAAGGG + Intronic
931108398 2:59083186-59083208 CGCTACAGGAAGCAGACACATGG - Intergenic
937359199 2:121217438-121217460 CTCAAATGGAAGGAGTCCCACGG - Exonic
938869682 2:135462329-135462351 CTGTACTGGATGCAGCCCCTGGG - Intronic
940300512 2:152172314-152172336 GTCAAATGGAAGCAGGCCAAAGG - Intronic
940881461 2:158951030-158951052 CTCTTCTAGAAGCAGGTCAATGG + Intergenic
945266746 2:207898364-207898386 CTGTCCCTGAAGCAGGCCCAAGG - Intronic
946183977 2:217966502-217966524 CTTAACTGGATGCAGGCCCTGGG - Intronic
1169158243 20:3352748-3352770 CTCTACTGCAGGTCGGCCCAAGG + Intronic
1169954106 20:11082280-11082302 TTCTACTGAAAGCAGAACCAAGG + Intergenic
1171032574 20:21690906-21690928 CTCTGCTCCCAGCAGGCCCATGG - Intergenic
1172147226 20:32764956-32764978 CCCCACTGGCAGCAGGTCCATGG - Intronic
1172451089 20:35023619-35023641 CTGTTCTGGAAGCTGGGCCAAGG - Intronic
1173398454 20:42702632-42702654 CTGTAATGAATGCAGGCCCATGG + Intronic
1174443272 20:50573216-50573238 GACGACTGGCAGCAGGCCCAGGG - Intronic
1175259176 20:57664015-57664037 GTCTCCTGGAAGCAGCACCATGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176210855 20:63920590-63920612 TTCTGCTGGCAGCAGCCCCAGGG - Intronic
1179921804 21:44511678-44511700 CTCCACTGGAAGGACGCCCAGGG - Intronic
1180814978 22:18783724-18783746 CTCGGGGGGAAGCAGGCCCAGGG - Intergenic
1181474323 22:23159104-23159126 CTCTCCTGCAGGGAGGCCCAGGG - Intronic
1181603187 22:23964384-23964406 TTCTACTGGAGGCAGGTCCTTGG - Intergenic
1181605327 22:23976923-23976945 TTCTACTGGAGGCAGGTCCTTGG + Intronic
1182221840 22:28764851-28764873 CTCCACTGGAAGAAGACCCTTGG - Intergenic
1183743402 22:39680311-39680333 CTGCTCTGGAGGCAGGCCCATGG - Intronic
1184200883 22:42968608-42968630 CTCTTCTGGAAACAGCCCCATGG - Intronic
1185089060 22:48755788-48755810 GACTTCTGGAAGCAGGCCCAGGG - Intronic
949262929 3:2123327-2123349 CTCCTCTGGAAGCAGGCAGAGGG - Intronic
950041709 3:9923967-9923989 CTGTACTGGAATCAGGTCCAGGG + Exonic
953360538 3:42292005-42292027 CTCTTTTGGAAGCAAGACCAAGG - Intergenic
953407191 3:42665286-42665308 CTCTGCTGCCAGCAGGCCCAGGG + Exonic
954914729 3:54139083-54139105 CTCTACTGCAGGCAAGCCCAGGG - Intronic
954959112 3:54549058-54549080 CTCTCTTAGAAGCAGGCTCATGG + Intronic
964277580 3:155024252-155024274 CTCCTCTGAAAGCTGGCCCAAGG + Intronic
971691817 4:29846445-29846467 TTCTTGTGGAAGCAGGCCCAGGG + Intergenic
973967733 4:56181265-56181287 CTCTACCTGGAACAGGCCCAGGG - Intronic
974482432 4:62462953-62462975 CTGTACAGGAAGCATGGCCAGGG - Intergenic
975651768 4:76600219-76600241 ATCTAATAGATGCAGGCCCAAGG - Intronic
977812026 4:101367312-101367334 CTCTACGGGAAGCAGTGCTAGGG + Intergenic
981260210 4:142709646-142709668 CTGTACAGGAAGCATGGCCAGGG - Intronic
984636780 4:182119453-182119475 CTCTGCTGGAACCAGTGCCAGGG - Intergenic
984942207 4:184942972-184942994 CTGTACAAGAAGCAGGCCCCAGG + Intergenic
986424307 5:7614975-7614997 CTCTACAGGAAGCATGGCCGAGG + Intronic
987214041 5:15714369-15714391 CTGTACTGGAAGCATGCCTGTGG - Intronic
990065780 5:51712562-51712584 CTGGAATGGAAGCAGGCCTAGGG - Intergenic
992567640 5:78014961-78014983 ATTTACTGGAAGCAGTCTCAGGG + Intronic
995828238 5:116325444-116325466 CTCTGCTGGAACCAGTACCAGGG + Intronic
998401292 5:141850348-141850370 CTCCACGGGACGCAGGCCCGAGG + Intergenic
999284719 5:150387564-150387586 CCCTACTGGAAGCAAAGCCACGG - Intronic
1000118305 5:158173959-158173981 CACTTCTGAAAGAAGGCCCAGGG - Intergenic
1000548977 5:162635183-162635205 CTGTACTGGAAGCATGGCCTGGG + Intergenic
1004563282 6:16771642-16771664 CTCCAGTGGTAGCAGTCCCAGGG - Intergenic
1006922315 6:37634949-37634971 CTCTGAGGGAAGCAGGCACAGGG + Exonic
1007605626 6:43115990-43116012 CACTCCTGGACCCAGGCCCATGG - Intronic
1007732155 6:43953927-43953949 CTCTGCTGGACCCAGCCCCAAGG + Intergenic
1011386409 6:86802772-86802794 ATCTCCTGGAAGCAGCCACATGG - Intergenic
1013188128 6:107779479-107779501 CCCAACTGGAAGCAGGATCAAGG + Intronic
1013286663 6:108687936-108687958 CACTACTGGACTCAGGCCCTTGG + Intergenic
1013676659 6:112471381-112471403 CTCTGCTGGCAGCAGCTCCAGGG - Intergenic
1014222896 6:118816128-118816150 CTCTCCTGGAGGCAGCCCCGAGG - Exonic
1015890032 6:137961093-137961115 CTCTACAGGAAGCATGGCTAGGG - Intergenic
1015953349 6:138575865-138575887 CCCTCCTGGCAGCAGGGCCAAGG + Intronic
1017721939 6:157249605-157249627 CTCCACTGGAACAAGGCTCATGG - Intergenic
1018677646 6:166236668-166236690 CTGGGCTGGAAGCACGCCCAGGG + Intergenic
1019378795 7:711032-711054 CTCTCCTGGAAGGAGGTTCAGGG - Intronic
1020120457 7:5500437-5500459 CTCTGCTGGAAGCTGGCGGAGGG - Intronic
1022529841 7:31059988-31060010 CTCTTCTGGAACTAGACCCAGGG - Intronic
1024530427 7:50387563-50387585 CCCGGCAGGAAGCAGGCCCAAGG - Intronic
1025751600 7:64298615-64298637 CCTTACTGGAAGCAGGACCCAGG + Intergenic
1026328927 7:69335362-69335384 CTCATCTAGAAGCAGGCCGATGG - Intergenic
1028600209 7:92592711-92592733 CTCTGAGGGAAGCTGGCCCAGGG - Intergenic
1029921614 7:104270566-104270588 CTCTCCTGGAAGGAGGCTCAGGG - Intergenic
1031869961 7:127080726-127080748 GTCTCCTGGTAGCAGGTCCAGGG - Intronic
1032184621 7:129713709-129713731 GTCTACTGGCAGCAAGCCCAGGG + Intronic
1034260689 7:149753457-149753479 CTCTACAGGAGCCAGACCCAGGG - Intergenic
1035016998 7:155775185-155775207 CTCCTCTGGAATCAGGCCCGTGG - Exonic
1035989220 8:4469654-4469676 CTCGTCTGGAAACAGGCCCAGGG + Intronic
1038670179 8:29576870-29576892 CTCTCCTCCAGGCAGGCCCAGGG - Intergenic
1039571521 8:38590465-38590487 CTCTGCCTGAAGCAGGCCCAAGG - Intergenic
1044412885 8:91903642-91903664 CTGTACAGGAAGCATGGCCAGGG + Intergenic
1045494293 8:102695363-102695385 ATCTTCTGGAAGCAGCTCCAAGG - Intergenic
1045770795 8:105737643-105737665 CTTTTCTGGAGGCAGACCCAGGG + Intronic
1047356886 8:124130192-124130214 CTCTACTTGAGGGAGCCCCATGG + Intergenic
1049538006 8:143191401-143191423 CTGTACAGGAAGCAGGGCCAGGG + Intergenic
1049744774 8:144258627-144258649 CTCTCCAGGAAGCAGGCTCTGGG - Intronic
1049772662 8:144390943-144390965 CTCTACGTGAAGCTGGGCCAGGG + Exonic
1051767658 9:20542200-20542222 CTCTTCTGTAACCAGGCACATGG + Intronic
1052326339 9:27220084-27220106 CTCTACGAGAAGCTGCCCCAGGG + Exonic
1055514851 9:77023864-77023886 CTCTCCTGAAAGCAGGACCGAGG - Intergenic
1056625926 9:88253013-88253035 CTGTACTGGAGGCATGGCCAGGG - Intergenic
1058751153 9:108039481-108039503 CTCTTCGGGTAGCAGGGCCAAGG + Intergenic
1058806086 9:108593587-108593609 CTTTACAGGAAGCAAGGCCAGGG + Intergenic
1058832583 9:108832333-108832355 CTCTGCTGGAAGTTGGCCCTAGG + Intergenic
1061226092 9:129281779-129281801 CTCTTCTGGAAAAAGGACCAGGG + Intergenic
1061363625 9:130158851-130158873 CTCTTCTGGAATAAGGACCAGGG + Intergenic
1185466958 X:360953-360975 GTCTCCTGGCAGCAGCCCCATGG - Intronic
1190925530 X:54900214-54900236 CTCCACTGGAAGCTGACCCTTGG - Intergenic
1191991523 X:67041867-67041889 TTCTCCTGGTAACAGGCCCATGG - Intergenic
1196495983 X:116326106-116326128 CTTAACTGGAAGCAGGGCCTGGG - Intergenic
1196986278 X:121275790-121275812 CTCTACAGGAAGCATGACTAGGG - Intergenic
1198162809 X:134024280-134024302 CTCAATTGGTAGCAGGCCAATGG + Intergenic
1202245061 Y:22811632-22811654 CTCTAGTGGAAGCAGGGTCCAGG - Intergenic
1202398051 Y:24445378-24445400 CTCTAGTGGAAGCAGGGTCCAGG - Intergenic
1202472730 Y:25224709-25224731 CTCTAGTGGAAGCAGGGTCCAGG + Intergenic