ID: 906713972

View in Genome Browser
Species Human (GRCh38)
Location 1:47953215-47953237
Sequence GATGATGCACAGAGGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906713964_906713972 20 Left 906713964 1:47953172-47953194 CCGAGAGCACCAGGCATGCAGGT 0: 1
1: 0
2: 1
3: 28
4: 257
Right 906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 218
906713965_906713972 11 Left 906713965 1:47953181-47953203 CCAGGCATGCAGGTACTGCACTT 0: 1
1: 0
2: 0
3: 14
4: 154
Right 906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906713972 Original CRISPR GATGATGCACAGAGGGGTGT GGG Intronic
900685678 1:3946214-3946236 GAGGATCCACACAGGGGTGCAGG - Intergenic
902232906 1:15039388-15039410 GAACATGCACTGAGTGGTGTGGG - Intronic
902462415 1:16588188-16588210 CATGATGCATAGAGGACTGTGGG - Intronic
902509219 1:16956592-16956614 GTGCATGAACAGAGGGGTGTGGG + Intronic
903118361 1:21196706-21196728 GATGATGGAGAGAGGGGGGATGG - Intergenic
903676006 1:25065104-25065126 GATGAGGCACAGAGAGGGGAAGG - Intergenic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
905275478 1:36815207-36815229 GATGTTGCCAAGAGGGATGTTGG - Intronic
906515507 1:46436740-46436762 GATAATGCTAGGAGGGGTGTAGG - Intergenic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
911416256 1:97578383-97578405 GATGATGCCCAGTGCGGTTTTGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913719298 1:121575268-121575290 GGTGATGTACAGAAGGGTTTTGG - Intergenic
915295993 1:154922354-154922376 GTTGATGCAGACAGGGGGGTAGG - Intergenic
917475135 1:175362884-175362906 AATAAAGCACAGATGGGTGTGGG + Intronic
917666094 1:177227171-177227193 GGGCATGCACAGAAGGGTGTGGG + Intronic
919852107 1:201679795-201679817 AGTGATGCAAAGAGGGATGTGGG + Intronic
920350925 1:205337493-205337515 GAGCAGGCACAGCGGGGTGTGGG + Exonic
920790511 1:209085577-209085599 GGTCATGCACTGAAGGGTGTAGG + Intergenic
921078139 1:211716326-211716348 GATGAGGCACTGAGGGGCTTGGG - Intergenic
922589501 1:226763855-226763877 GATGTTGGATAGAGGGGTGCAGG + Intergenic
922648921 1:227319338-227319360 GCGCATGCACACAGGGGTGTAGG - Intergenic
924848465 1:247798046-247798068 AATTATGCCCAGTGGGGTGTGGG + Intergenic
1062997690 10:1882162-1882184 GATGAGGCATAGGGGGCTGTGGG + Intergenic
1063636964 10:7791316-7791338 GATGATGCAGTCATGGGTGTGGG + Intronic
1063899706 10:10719704-10719726 GATGAGGCACAGAGAGGTTAGGG - Intergenic
1064153161 10:12882072-12882094 GATGATGTACAGAGTGATATGGG - Intergenic
1065785176 10:29206269-29206291 CAAGATGCACAGAAGGGTGCAGG + Intergenic
1068306269 10:55212363-55212385 GATGCTGCAGAGAGGGGTCCTGG - Intronic
1068610575 10:59056014-59056036 GTTTATGCACAGAGAGGTGGAGG + Intergenic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1072521949 10:96236898-96236920 GATCATTAACAGAGGGGTGGGGG + Intronic
1076920831 10:133453972-133453994 GCTGAAGCCCAGAGGGCTGTGGG + Intergenic
1077369110 11:2173317-2173339 GAGGAGCCACGGAGGGGTGTGGG - Intergenic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1078091421 11:8266865-8266887 GGTGATGCTCAGAGAGGTATTGG + Intronic
1079109284 11:17595271-17595293 TATGATGTACATGGGGGTGTGGG - Intronic
1082079131 11:47998470-47998492 GATGAGGCACAGAGAGGTGGAGG + Intronic
1083147765 11:60771688-60771710 GAGAATGCACGGAGGAGTGTGGG + Intronic
1083283135 11:61639792-61639814 GCTGATGCCCAGAGAGGTTTAGG + Intergenic
1086117918 11:83272968-83272990 AATGAAGCACAGAGGGGTTAAGG - Intronic
1086938841 11:92774061-92774083 TTTGATGCAGAGAAGGGTGTTGG + Exonic
1088418779 11:109619431-109619453 GAAGATGCACACATGGGTTTAGG + Intergenic
1089621669 11:119726251-119726273 GGTGATGCAAAGTAGGGTGTGGG + Intronic
1089990676 11:122856897-122856919 GATGACTCACAGAGGGGTGGGGG - Intronic
1090085005 11:123642830-123642852 GAAGAGGCACAGAGGAGGGTAGG + Intronic
1090093098 11:123716836-123716858 CAACATGCACAGAGGGCTGTGGG - Intergenic
1093776067 12:23075791-23075813 GGTGATGTACAGATGGGTTTTGG + Intergenic
1096387844 12:51206734-51206756 GGTGATGGAGTGAGGGGTGTGGG - Intronic
1097076542 12:56399058-56399080 GAAGAAGCAAATAGGGGTGTTGG - Intergenic
1098597002 12:72285312-72285334 GATGATGGAGAGAGGAGTGGTGG + Intronic
1101292766 12:103388367-103388389 TTTGATGCAGAGTGGGGTGTAGG - Intronic
1101963825 12:109268593-109268615 GCTGAGGCACAGAGAGGTGAAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106877773 13:34093620-34093642 CCTGATACACAGAGGAGTGTTGG - Intergenic
1110055326 13:70962646-70962668 GATGAAGCATAGAGAGGTGAGGG - Intergenic
1112362559 13:98730643-98730665 AACGATGCACTGAGGGCTGTGGG - Intronic
1114459827 14:22879215-22879237 GAAGTAGCAGAGAGGGGTGTGGG + Exonic
1114828307 14:26107259-26107281 GGTGATGTACAGATGGGTTTTGG - Intergenic
1116248860 14:42455845-42455867 CTTGAAGCAAAGAGGGGTGTTGG - Intergenic
1116997549 14:51339672-51339694 GATAAGGGCCAGAGGGGTGTGGG - Intergenic
1117554999 14:56875046-56875068 AATGAGGCACAGAGAGGTGAAGG + Intergenic
1117823422 14:59675137-59675159 TATGGTGCACAGAGGAGTGGTGG + Intronic
1119617120 14:76106157-76106179 GTTGATGCACAGAGAGGGGAGGG - Intergenic
1121487725 14:94331395-94331417 GATGAGGCCAAGAGGGGTTTGGG - Intergenic
1122019701 14:98827504-98827526 GATGATGGAGAGAGGGGTCAGGG + Intergenic
1122035473 14:98946191-98946213 GCTGCTGTACAGAGGGATGTTGG - Intergenic
1122273936 14:100581575-100581597 CCTGATGCACAGAGGCGGGTGGG - Intronic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1124513319 15:30346361-30346383 GGTGATGTACAGATGGGTTTTGG + Intergenic
1124651557 15:31477869-31477891 GAAGATGCAGAGAGGTGGGTAGG + Exonic
1124729604 15:32184404-32184426 GGTGATGTACAGATGGGTTTTGG - Intergenic
1126341413 15:47645155-47645177 GATGATCCACAGAGGGATAAAGG + Intronic
1126977063 15:54195264-54195286 AATGATGTAAACAGGGGTGTAGG - Intronic
1127152630 15:56093922-56093944 GATGATGCAGTGAGAGGTTTGGG - Exonic
1128596063 15:68950791-68950813 GATGAAACACAGAGGGTTTTAGG - Intronic
1130911811 15:88276047-88276069 AATGCTGCAGAGAGGGGTGCTGG - Intergenic
1130957761 15:88639324-88639346 GATGCTGGAGAGAGGGGTATGGG - Exonic
1131881729 15:96869220-96869242 GATGATGCCCTTAGGGTTGTGGG - Intergenic
1132724304 16:1332243-1332265 GATCCTGCACAGACAGGTGTGGG + Intergenic
1136298597 16:29318121-29318143 GAAAATGCACAGATGGGTGCAGG - Intergenic
1136999344 16:35215921-35215943 GAAGATGGACAGAGGGGTTAAGG + Intergenic
1137780389 16:51093407-51093429 GGTGTCTCACAGAGGGGTGTAGG + Intergenic
1137908657 16:52352919-52352941 GGGGATGCACAGATGGGTGAAGG - Intergenic
1138255834 16:55559137-55559159 TATGATGCACATAATGGTGTTGG - Intronic
1139842241 16:69890975-69890997 GATGGTCCAGAGAAGGGTGTCGG + Intronic
1141816947 16:86417413-86417435 GATGAGGCAGAGATGGGTCTGGG - Intergenic
1141848761 16:86629834-86629856 GATGGTGGAGAGAGGGGTATTGG + Intergenic
1142575033 17:901247-901269 GTTGAGGCTCAGAGGGGTTTTGG - Intronic
1147311497 17:39598529-39598551 GAGGGGGCACAGAGGGGTTTGGG + Intergenic
1151153893 17:72111067-72111089 GGTGATGCACTGAGGGGTCATGG - Intergenic
1156376726 18:36521416-36521438 GATGATGAACAGAGCTGTGGAGG - Intronic
1162568559 19:11457629-11457651 CCTGAGGCACAGAGAGGTGTTGG - Intronic
1162628585 19:11906657-11906679 GGTGATGTACAGATGGGTTTTGG - Intronic
1163029292 19:14533557-14533579 GGTAATGCCCAGAGGGGTGCAGG + Intronic
1164340738 19:24394886-24394908 GGTGATGTACAGATGGGTTTTGG - Intergenic
1165149916 19:33754109-33754131 GATGGTACACAGAGGGTAGTGGG - Intronic
1165375681 19:35440014-35440036 GAAGATGCACGGAGGGGGGTGGG + Intergenic
1166557447 19:43710302-43710324 GAAGCTGCCCAGAGAGGTGTGGG - Intergenic
1167969435 19:53178248-53178270 GATGTTGCACAAAAGGATGTTGG - Intronic
925296675 2:2781563-2781585 GAAGATAAACAGATGGGTGTGGG - Intergenic
925541706 2:4974394-4974416 CATGCTGCACACTGGGGTGTTGG + Intergenic
925962682 2:9033417-9033439 GATAATGCAGAGAGGAGTGTTGG + Intergenic
928436407 2:31257327-31257349 AAGGATGGACAGAGGGATGTAGG + Intronic
932434741 2:71696428-71696450 GATGAGCCACAGAGGGCTGAAGG - Intergenic
935938507 2:108213710-108213732 GGTGATGTACAGATGGGTTTTGG + Intergenic
939924261 2:148154096-148154118 GGTGATGTACAGATGGGTTTTGG + Intronic
940262211 2:151792833-151792855 GAAGATGCCCAGAGTGGTGGTGG + Intronic
940792934 2:158047343-158047365 CATGATGCCCCCAGGGGTGTTGG + Intronic
942734259 2:179092559-179092581 GGTGATGTACAGATGGGTTTTGG + Intergenic
944663357 2:201939461-201939483 GATGATGCACAGAGTCGGGCAGG - Intergenic
945669533 2:212786097-212786119 GGTGATGTACAGATGGGTTTTGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
947856643 2:233328666-233328688 GCTGGTGAAGAGAGGGGTGTGGG - Intronic
948467947 2:238161126-238161148 GAGGATGGACAGAGGAGGGTTGG + Intronic
1168789443 20:566333-566355 GATGGTGCACAGAGGAGAATGGG + Intergenic
1168940570 20:1707726-1707748 GATGGTGCACAGAGAGGGCTGGG + Intergenic
1169002495 20:2178062-2178084 AATGACACACAGAGGGCTGTGGG - Intergenic
1170061182 20:12260858-12260880 GAGGATGCACAGTGGGCTGCAGG + Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1174536431 20:51254903-51254925 GATGAGGCACTGAAGGGTTTGGG - Intergenic
1175332050 20:58171920-58171942 GATGAGGAGCAGAGGTGTGTTGG - Intergenic
1175533034 20:59687267-59687289 GATGATGATCATAGTGGTGTTGG + Intronic
1175904899 20:62374948-62374970 GCTCATGCACAGAGAGGTGGGGG + Intergenic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1177925419 21:27208355-27208377 GATGATGCGCAGGGGGGTTATGG - Intergenic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1180062649 21:45393639-45393661 AAAGGTGCACAGAGAGGTGTTGG + Intergenic
1180855453 22:19042210-19042232 GGTGATGGTCAGAGGGGTGTTGG - Intronic
1181010361 22:20036788-20036810 GATGATGCACATGGTGGTGCAGG - Exonic
1181151737 22:20888716-20888738 GGTGATTCCCAGAGGGGTGGAGG - Exonic
1181856416 22:25784522-25784544 CACGAGGCAGAGAGGGGTGTGGG + Intronic
1182007415 22:26972338-26972360 AAAGCCGCACAGAGGGGTGTTGG + Intergenic
1183362162 22:37388317-37388339 GAGGAAGCACAGGGGGCTGTGGG - Intronic
1185201137 22:49506193-49506215 CATGAAGCACAGAGGAGTGAGGG - Intronic
1185275965 22:49950353-49950375 GGGGAAGCACAGAGGGGTGGGGG + Intergenic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
950896453 3:16455976-16455998 GATAATGCAGAGACGGGGGTGGG - Intronic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
952862754 3:37828299-37828321 AATGCTGCACAGAGGGATGATGG - Intergenic
954678080 3:52326590-52326612 GATGAGTCTCAGAGGGGTGGAGG + Intronic
955341662 3:58129948-58129970 GATGAAGCACAGAGGAGTCGAGG - Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
955887285 3:63614043-63614065 GATGATCCACAGTGGCCTGTGGG - Intronic
956587604 3:70881112-70881134 GGTGATGGGCAGAGGGGTGATGG + Intergenic
956924541 3:73969797-73969819 GATGATTCACAGAGTGGTTAAGG - Intergenic
960172750 3:114481879-114481901 GATGATGCAAAGAACGGTGGGGG + Intronic
960201767 3:114845492-114845514 GGTGAGGCACAGAGGTGGGTAGG - Intronic
960493749 3:118350684-118350706 AATGATGAAGGGAGGGGTGTGGG - Intergenic
960753090 3:120978701-120978723 GGTGATGTACAGATGGGTTTTGG + Intronic
961448403 3:126991736-126991758 GCAGAGGCACAGAGGGGAGTGGG - Intronic
962942974 3:140142359-140142381 GATGAGGCTCAGAGGACTGTGGG + Intronic
963988791 3:151629117-151629139 GAAGAGGCACAGAGCGCTGTTGG - Intergenic
967817107 3:193808891-193808913 CAAGATACACAGAGGGGTTTAGG - Intergenic
968762978 4:2451845-2451867 GATGATGGACACAGGGTTGGTGG + Intronic
968944861 4:3658332-3658354 GAGGAAGCACACAGGGGAGTGGG - Intergenic
971119852 4:23691105-23691127 GATGATGAAGAGAGGGGATTGGG + Intergenic
974220899 4:58969505-58969527 GATGAGGCTCAGAGAGGTGAAGG - Intergenic
975380425 4:73694239-73694261 GATGAGGCAGAGAGGTGTGTGGG + Intergenic
975567112 4:75769075-75769097 CATGTTGCACAGAGGAGTGTGGG - Intronic
982691165 4:158549607-158549629 GGTGATGTACAGAGGGTTTTTGG + Intronic
983101675 4:163633081-163633103 GGTGATGTACAGATGGGTTTTGG - Intronic
983694336 4:170510251-170510273 GGTGACGTACAGAGGGGTTTTGG + Intergenic
986001137 5:3631755-3631777 GAGGATCCTCAGAGGGGTGATGG - Intergenic
986691118 5:10314760-10314782 GATGAGGCACAGCGGGGTTGGGG - Intergenic
986711691 5:10492621-10492643 GAAGATGAACAGAGGGGCGGTGG + Intergenic
987557341 5:19471200-19471222 GAAGAGGCACTGAGGGGTGTGGG - Intergenic
988961994 5:36379704-36379726 AATGATTCCCAGAGGGGTCTAGG + Intergenic
989086236 5:37679388-37679410 GGTGATGTACAGATGGGTTTTGG + Intronic
989195601 5:38713445-38713467 GAGGATGCACAGCTGGGTGACGG + Intergenic
989205708 5:38807177-38807199 GATGATGACCAGAGGGTTGGGGG - Intergenic
989949552 5:50281066-50281088 GGTGATGTACAGATGGGTTTTGG - Intergenic
990177141 5:53120335-53120357 GATAAAGCACAAAGGTGTGTGGG - Intergenic
990843020 5:60104848-60104870 GGTGATGTACAGATGGGTTTTGG - Intronic
991451085 5:66751131-66751153 GGTGATGTACAGATGGGTTTTGG - Intronic
991608326 5:68425375-68425397 GATGATTCACAGGGAGATGTCGG + Intergenic
993152890 5:84183299-84183321 GTTGATGCTCTGAGGGGTATAGG - Intronic
994424154 5:99562901-99562923 GGTGATGTACAGATGGGTTTTGG + Intergenic
995409277 5:111836341-111836363 GAATATACAGAGAGGGGTGTGGG + Intronic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
997527817 5:134564718-134564740 GATGGGCCCCAGAGGGGTGTGGG + Intronic
997596613 5:135111433-135111455 TCTGAGTCACAGAGGGGTGTGGG - Intronic
998001561 5:138629976-138629998 GATCCTGCACTGAGGGGAGTTGG + Intronic
998188314 5:140000293-140000315 GTTCAAGCACAGAGGTGTGTAGG - Intronic
999691260 5:154147833-154147855 TATGATGCACAGAGGGTTCCAGG - Intronic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
1001489941 5:172148251-172148273 GATCATGCACAGAGTGGGATTGG - Intronic
1002110120 5:176903083-176903105 GATGTTGCACTGAGGGGTGGAGG - Intergenic
1002770077 6:282880-282902 CATGATGCTCAGAGAGATGTGGG + Intergenic
1003026303 6:2558535-2558557 GAGGATGCTCACAGGGGTGTGGG - Intergenic
1003078975 6:3005836-3005858 GTTGAGGCACAGAGGGGTGGAGG + Intronic
1003491686 6:6627809-6627831 ACTGAAGCACAGAGGGGTTTAGG + Intronic
1004871650 6:19911009-19911031 GATGATGGACAGAGGAGAATAGG + Intergenic
1006929763 6:37680720-37680742 GCTGAGGCCCAGAGGGGAGTTGG - Intronic
1007330966 6:41108204-41108226 CATGATGCACAGAGCCATGTGGG + Intergenic
1012089452 6:94873439-94873461 GGTGATGTACAGATGGGTTTTGG + Intergenic
1012654044 6:101793364-101793386 GGTGATGTACAGATGGGTTTTGG + Intronic
1013858454 6:114604563-114604585 GAGGATGGAAAGAGGGGTGAGGG + Intergenic
1014266731 6:119286414-119286436 GAGGAAACACAGAGGGGAGTAGG - Intronic
1015633293 6:135252376-135252398 GATGAGGCACAGAGGGAGGCCGG - Intergenic
1017962033 6:159231976-159231998 AAGCAGGCACAGAGGGGTGTTGG - Exonic
1018026783 6:159813123-159813145 GATGCCGCACAGATGGGAGTGGG + Intronic
1020412107 7:7903754-7903776 GATGATGCACATATGAGTGTTGG - Intronic
1020436070 7:8163817-8163839 GATGAGGCAGAGAGGTGAGTTGG + Intronic
1024755564 7:52526077-52526099 GATGAAGCCCAGAGGGCTGCTGG + Intergenic
1024765602 7:52654597-52654619 GATGATGCAGAGGTGAGTGTGGG - Intergenic
1025020169 7:55474460-55474482 AATGAGGCACTGAGGGCTGTCGG + Intronic
1026491019 7:70863559-70863581 TATGATGCACAGAGAGCTGGTGG + Intergenic
1029310469 7:99659233-99659255 GGTGATGTACAGATGGGTTTTGG + Intronic
1031596478 7:123655792-123655814 GACAATGCAGAGAGGGGTGAAGG - Exonic
1034431588 7:151043805-151043827 GAGGATGCACAGTGCGGGGTGGG + Intronic
1034563649 7:151896903-151896925 GGTGAAGTAAAGAGGGGTGTGGG - Intergenic
1035452582 7:158987772-158987794 GATGATGCATAGATGGATGAAGG - Intergenic
1035496256 7:159329384-159329406 GAGTATGCTCAGGGGGGTGTTGG + Intergenic
1035496364 7:159330649-159330671 GATGAGGCACAGAAGAGTGGTGG - Intergenic
1035791183 8:2307122-2307144 GGTGATGTACAGATGGGTTTTGG + Intergenic
1035801622 8:2414583-2414605 GGTGATGTACAGATGGGTTTTGG - Intergenic
1038438357 8:27554558-27554580 GGTGATGAACAGATGGGTTTTGG + Intergenic
1044903955 8:96979507-96979529 CATGATGCAGAGAAGCGTGTAGG - Intronic
1048518872 8:135135817-135135839 AATGAAGCACAGAGTGGTGCAGG + Intergenic
1049348438 8:142151538-142151560 GCTAATGTCCAGAGGGGTGTCGG - Intergenic
1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG + Intronic
1055307490 9:74944662-74944684 AATGATGCACAGAGGTGTATTGG - Intergenic
1057062276 9:92016376-92016398 GTTGAGGCACAGAGAGGTGAGGG - Intergenic
1061316737 9:129801098-129801120 CAGGATGCACAGAGGCCTGTGGG - Intergenic
1062174294 9:135152482-135152504 GAGGGAGCACAGAGGGATGTAGG - Intergenic
1062420180 9:136476931-136476953 GATGTTGCCCCGAGGGCTGTGGG + Exonic
1062612345 9:137380654-137380676 GGGGATGCCCAGAGGGGGGTTGG - Intronic
1203773655 EBV:61440-61462 GAAGATGCGCAGAGGGGTTACGG + Intergenic
1185654171 X:1670804-1670826 GAGGATACACAGAGGAGTTTAGG - Intergenic
1189230929 X:39451709-39451731 GAGGATGCAGAGAGGGGAATGGG + Intergenic
1192204344 X:69086225-69086247 GATGAGGCCCAGAGAGGTGAAGG - Intergenic
1197568936 X:128125184-128125206 GATGATGCACAGAAAGCTTTTGG + Intergenic
1198553432 X:137768472-137768494 GGTGATGTACAGATGGGTTTTGG + Intergenic
1198615760 X:138456812-138456834 GGTGATGTACAGATGGGTTTTGG - Intergenic
1199604163 X:149563406-149563428 TATGAAGCACAGAGGTTTGTAGG - Intergenic
1200056239 X:153462835-153462857 GCTGATGCCCAGAGAGGGGTGGG - Intronic