ID: 906714273

View in Genome Browser
Species Human (GRCh38)
Location 1:47955348-47955370
Sequence TATTCTGTGCTGTAGACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906714273 Original CRISPR TATTCTGTGCTGTAGACAAC TGG (reversed) Intronic
903001017 1:20265920-20265942 TATTCTGCTCTGAAGAGAACTGG - Intergenic
904505935 1:30953981-30954003 TATCCTGTTCTGTAACCAACAGG - Exonic
905229554 1:36506438-36506460 TTTTCTGAGCTCTAGCCAACAGG + Intergenic
906714273 1:47955348-47955370 TATTCTGTGCTGTAGACAACTGG - Intronic
906811993 1:48836539-48836561 TCTTTTGTGCAGTAGACACCTGG - Intronic
907986850 1:59540509-59540531 AATCCTGTGGTGTAGACATCTGG + Intronic
908150059 1:61291078-61291100 AAGCCTGTGCTGTAGACCACTGG + Intronic
908802262 1:67892418-67892440 TATTCCTTGATGTGGACAACTGG - Intergenic
910502280 1:87906401-87906423 AATTAGGTGCTGTAGACAAAAGG + Intergenic
914349504 1:146828056-146828078 TATTCTTTTCTGGAGACACCAGG + Intergenic
914624067 1:149442113-149442135 CATTCTGTGCTCAAGAAAACAGG + Intergenic
915567503 1:156723974-156723996 CATTCTATGAGGTAGACAACAGG + Intronic
917809242 1:178641720-178641742 TATTCTGCGCTGGAGAATACAGG + Intergenic
917917310 1:179715613-179715635 TATTCTGTGCTCTGGACAGCAGG - Intergenic
918443663 1:184594729-184594751 TATTTTGAGCTAAAGACAACTGG - Intronic
918668441 1:187180755-187180777 AATTCTTTGCTGTATACAAGAGG - Intergenic
920968313 1:210720527-210720549 GAATCTGTGCTGAAGACAAAGGG + Intronic
921240283 1:213173566-213173588 TATTCTATACTGTATACAATTGG - Intronic
1066202110 10:33151816-33151838 TGTTCAGTTCTGGAGACAACAGG + Intergenic
1067109147 10:43387166-43387188 TAGCCTGTGCTGTAGGCACCAGG + Exonic
1067270934 10:44790743-44790765 TCTTCTGCTCTGTAGAGAACAGG + Intergenic
1067536732 10:47116157-47116179 TGTTCTGAGATGTAGACCACAGG - Intergenic
1068209923 10:53908213-53908235 TATTCTGTGATGAACAGAACAGG + Intronic
1073299591 10:102462700-102462722 GATTCTATGCTGAGGACAACAGG - Intronic
1073693762 10:105841898-105841920 TATTATGTGCTGAACACATCAGG + Intergenic
1073846074 10:107556203-107556225 TATTCTGTGATGTATATTACAGG + Intergenic
1074752938 10:116604387-116604409 TATTGAGTTCTGTAGACAACTGG - Intronic
1076548011 10:131258691-131258713 TTATCTGTCCTGTAGATAACTGG - Intronic
1080057558 11:27922827-27922849 CCTTCTGAGCTGTAGACAACAGG - Intergenic
1080218085 11:29868486-29868508 TGTTCTATGCTGTGGACAACAGG - Intergenic
1082662386 11:55927786-55927808 GATTCAGTGCTGTAGTCACCAGG + Intergenic
1084684473 11:70685660-70685682 CATTCTGTCCTGGAGAGAACGGG + Intronic
1084930631 11:72552994-72553016 TTCTCTGTGCTGCAGACACCAGG + Intergenic
1086534494 11:87828454-87828476 TAATCTGTACTGCAGACAATGGG + Intergenic
1090060917 11:123463527-123463549 TGTTCTCTGATGTAGCCAACAGG + Intergenic
1091990291 12:4949809-4949831 CATTCTGTGCTGTATAGAAGAGG + Intergenic
1093349834 12:18085244-18085266 TATTATGTTCTATTGACAACTGG + Intronic
1093756581 12:22859593-22859615 TGTACTGTGCTGTGGATAACTGG - Intergenic
1096519348 12:52175519-52175541 ACTTCTGAGCTGTAGACGACAGG + Intronic
1100781131 12:98027705-98027727 AACTCTGTGCTTAAGACAACAGG + Intergenic
1106385315 13:29279277-29279299 TCTTCTGTGCTGTGGTCAAGTGG + Intronic
1114214271 14:20644210-20644232 TGTTCTGTGCTGTAGCCCAAAGG - Intergenic
1114799088 14:25751539-25751561 TTTTCTGTTGTGTAGACCACAGG + Intergenic
1117300225 14:54418427-54418449 TATCCTTTGCAGTAGATAACTGG + Intronic
1117550675 14:56833034-56833056 TATTCTGTGCTTCAGCCAATTGG - Intergenic
1122593966 14:102876219-102876241 TACTCTTTGCTGTGGAAAACTGG + Intronic
1127665314 15:61140442-61140464 TATTCTGTGATGTTGCCACCCGG + Intronic
1131873390 15:96782074-96782096 TATTCTGTGCTGTACCCACAAGG + Intergenic
1133513794 16:6486811-6486833 TATTATGAGCAGTAGTCAACAGG + Intronic
1133638337 16:7691937-7691959 TATTCTGGGCTGCACAAAACAGG - Intronic
1139984533 16:70887498-70887520 TATTCTTTTCTGGAGACACCAGG - Intronic
1140014976 16:71173866-71173888 TTTTCTGTGCTGGAGAAAATAGG - Intronic
1141117485 16:81322740-81322762 TATTCAGAGGTGTAGGCAACTGG - Intronic
1149536076 17:57434450-57434472 TATGCTGTTCTGTAGATCACTGG + Intronic
1151916377 17:77121197-77121219 TGTTCTTAGCTGCAGACAACAGG - Intronic
1152755148 17:82084106-82084128 TAGGCCGTGCTGTAGACGACAGG + Exonic
1157267139 18:46235384-46235406 TATACTCTGCTGTACACCACTGG - Intronic
1159153876 18:64556678-64556700 TATTCTGTGCTGAATACACCAGG - Intergenic
1168550917 19:57292762-57292784 TGTCCAGTGCTGTAGACAAACGG + Exonic
925049288 2:799261-799283 TATTCTTTGCTGCAGATGACAGG + Intergenic
927308571 2:21602156-21602178 TATTAAATGCTGTAGGCAACTGG + Intergenic
927543353 2:23931487-23931509 TAGTATGTACTGTAGAAAACAGG - Intronic
930003583 2:46879075-46879097 TGGTCTGTGCTGGAGACAGCTGG - Intergenic
934981590 2:98847817-98847839 CATTCTGTGCTGTGTACAAGTGG - Intronic
935599524 2:104908737-104908759 CATTCTTTGCTGTAGACCATTGG - Intergenic
935805524 2:106743942-106743964 GATTCCTTGCTGTAGACAATGGG + Intergenic
936882433 2:117270114-117270136 CAGTGTGAGCTGTAGACAACTGG + Intergenic
942020410 2:171862168-171862190 TCTCCTGTGATGTAGAAAACTGG - Intronic
943041139 2:182807029-182807051 TATTTTGTGCTGTAGACAAAGGG - Intergenic
943943368 2:194027736-194027758 TATTATGTGCAGTAAAAAACTGG + Intergenic
944509642 2:200451881-200451903 TATTTTGTGCTTGAGACAAAGGG + Intronic
946647855 2:221857928-221857950 TATACTGTGGTGTTGACAACTGG - Intergenic
1169728413 20:8761255-8761277 TAATCTGTGCTGTAGAAACCTGG + Intronic
1170071767 20:12376780-12376802 TTTTCTGTGCTTTAGATAAAAGG + Intergenic
1171370631 20:24660019-24660041 TGTTTTGTGCTGTAGATAATAGG + Intronic
1176921699 21:14695360-14695382 TATTCTGAGCTGGAGAAATCTGG - Intergenic
1177857158 21:26412467-26412489 TATTGAGTTCTGTAGAGAACCGG - Intergenic
1178446237 21:32646269-32646291 TATTCTGTACCGGAGAAAACAGG + Intronic
1183872283 22:40748931-40748953 TTTGCTGTGCTGTAGGCAGCAGG + Intergenic
949258097 3:2074078-2074100 TATTCTGTGCTGTACAGTATTGG - Intergenic
949392670 3:3579678-3579700 TTTGCTGTGCTGTTGCCAACAGG + Intergenic
949980938 3:9501323-9501345 AAGTCTGTGCTGTACAAAACAGG + Exonic
950026507 3:9823906-9823928 TTTTCTGTCTTGTAGAGAACAGG + Intronic
951179999 3:19648609-19648631 GAATCTGTACTGTAGACCACTGG - Intergenic
951480509 3:23156880-23156902 CATTTTCTGCTGTAGACATCAGG + Intergenic
951989403 3:28659216-28659238 TATGCTGTCCTGTAGAAGACAGG + Intergenic
952341464 3:32451132-32451154 AATTATGTGCTGTAGACAATTGG + Intronic
952973615 3:38674295-38674317 AATTCTGTGTTGAAGATAACTGG + Intergenic
954503943 3:51050400-51050422 TATTCTGTTCAGTAAACAGCAGG + Intronic
958138789 3:89533268-89533290 TGTGCTGTGCTGTACACAATCGG + Intergenic
958724984 3:97894213-97894235 TTTTCTGTGCAGTAGAAAATTGG - Intronic
959762475 3:109982857-109982879 TATGCTGTGCTATAGAAAAAAGG - Intergenic
960842056 3:121969397-121969419 TATTTTGAGCTGAAGACAAGTGG - Intergenic
962461885 3:135621708-135621730 GAATCTGTGTTGTAGACAACTGG + Intergenic
965635403 3:170775456-170775478 TATTATGTGCCCTAGATAACAGG + Intronic
967885329 3:194329822-194329844 TTTTCTGTGCTGCTGACAACTGG + Intergenic
968027466 3:195454540-195454562 TCTTGTGTGCTGGAGACAATGGG - Intergenic
975827862 4:78338716-78338738 GATACTGTGATCTAGACAACTGG - Intronic
975907692 4:79234198-79234220 TATCCTTTGCTGTAGAAAATTGG + Intronic
978348581 4:107797757-107797779 TGTTCTGAGCTCTAGCCAACTGG + Intergenic
978669352 4:111227679-111227701 TGTTCTGTGCTATATACCACAGG + Intergenic
984617734 4:181917335-181917357 TGTTATGTGCTATAGATAACTGG - Intergenic
985682736 5:1265040-1265062 TCTGCTGTGCTTTAGACAAAGGG + Intronic
985764761 5:1771372-1771394 TATTCTGCACTGTAAACAACAGG - Intergenic
988005331 5:25403127-25403149 TCTTCTCTTCTGTAGACAAAGGG + Intergenic
990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG + Exonic
991342077 5:65622784-65622806 AATTCTGTGCTGTAAGAAACTGG + Intronic
993401437 5:87457511-87457533 TACTTTGTGTTGCAGACAACTGG - Intergenic
996462563 5:123763404-123763426 TAATCTGTACTGTAGACAAATGG - Intergenic
998539489 5:142966826-142966848 TAATCTGTGTTTTAGCCAACAGG + Intronic
1001546676 5:172574713-172574735 TTTTCTCTGGTGTAGCCAACTGG - Intergenic
1003336071 6:5173873-5173895 GAAGCTGTGCTGGAGACAACAGG + Intronic
1007750368 6:44067473-44067495 TATCCTATGCTGTAGCCACCTGG + Intergenic
1010627042 6:78150785-78150807 TCTTCTGCGTTGTAGACAATTGG - Intergenic
1015354464 6:132260889-132260911 TAGTCTGTACTGGAAACAACTGG + Intergenic
1018569916 6:165198361-165198383 CATTCTGTGCTATAGTCAGCTGG - Intergenic
1021909022 7:25365588-25365610 GCTTCTGTGCTGTAGGCAGCTGG + Intergenic
1028930226 7:96404745-96404767 CATCCTGTGCTGTAGTCACCTGG - Intergenic
1030573759 7:111260463-111260485 TATTCTGCTCTGTAGTGAACTGG - Intronic
1042471106 8:69188983-69189005 TATGATCTGCTGTAGAGAACAGG - Intergenic
1044057438 8:87588635-87588657 CATTCTGTTCTGTAGGCACCAGG + Intronic
1045547852 8:103143754-103143776 TCTTCTGTGCTGAACACATCTGG + Intronic
1049912443 9:282311-282333 TAGTCTCTCCTGTAGATAACAGG + Intronic
1051186629 9:14467228-14467250 TATTCCGTGCTAAAGAGAACTGG + Intergenic
1051523334 9:18014958-18014980 TAATCTCGGCTGTAGACATCAGG + Intergenic
1052677274 9:31643595-31643617 TATTCTTAGCTGTGGACAAAGGG - Intergenic
1053702869 9:40716385-40716407 TATTTTGAGCTTGAGACAACTGG - Intergenic
1054412929 9:64839847-64839869 TATTTTGAGCTTGAGACAACTGG - Intergenic
1056231612 9:84551404-84551426 TAGTCTTTGTTCTAGACAACTGG + Intergenic
1058577398 9:106418481-106418503 TAATCTATCCTGTAAACAACTGG - Intergenic
1059219446 9:112599562-112599584 TATTCTGTGCTGTATACTAATGG + Intronic
1060110513 9:120903468-120903490 TATGCTGGGCTGGAGAGAACAGG + Exonic
1186611496 X:11142417-11142439 TATTCTGTTTTGTATACAACAGG - Intronic
1188908803 X:35820648-35820670 CATTCTGTGCTGTGAGCAACAGG - Intergenic
1189974210 X:46446314-46446336 CCTTCTGTGCTGGAGCCAACTGG - Intergenic
1194508023 X:94757214-94757236 GATTCTGAGGTCTAGACAACTGG - Intergenic
1196137104 X:112221928-112221950 TTCACTGTGTTGTAGACAACAGG + Intergenic
1196522543 X:116691263-116691285 TATTATATACTGTTGACAACTGG + Intergenic
1196578641 X:117352647-117352669 TATTATGTACTGTAGTCACCTGG + Intergenic
1199462202 X:148097074-148097096 AATTGTATGCTGTAAACAACAGG + Intergenic