ID: 906715068

View in Genome Browser
Species Human (GRCh38)
Location 1:47962525-47962547
Sequence ATATTATTATTAAGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906715068_906715072 25 Left 906715068 1:47962525-47962547 CCCTTTGCCCTTAATAATAATAT 0: 1
1: 0
2: 1
3: 47
4: 432
Right 906715072 1:47962573-47962595 ATTAGTCCTTACCACGTGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906715068 Original CRISPR ATATTATTATTAAGGGCAAA GGG (reversed) Intronic
902312552 1:15592699-15592721 ATATTTTTATTTAGGGCTAGGGG - Intergenic
903537317 1:24075564-24075586 AGTTTATTATTAAGTGCAACAGG - Intronic
904452158 1:30620701-30620723 ATATTCTTATTAAATTCAAATGG - Intergenic
906715068 1:47962525-47962547 ATATTATTATTAAGGGCAAAGGG - Intronic
907124126 1:52034036-52034058 ATTTTATTAATAAGGCCTAAGGG + Intronic
907613807 1:55902261-55902283 ATTATATGAATAAGGGCAAAGGG - Intergenic
908287342 1:62621548-62621570 ATATAATGATGAAGAGCAAATGG - Intronic
908493898 1:64674946-64674968 TTATTATTATAAAAGGAAAAAGG + Intronic
908663034 1:66458262-66458284 ACATTATTTTCAAGTGCAAATGG - Intergenic
908793057 1:67802293-67802315 ATATTGTAAATTAGGGCAAATGG + Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909426394 1:75530181-75530203 TTATTATTATTAACAGAAAAGGG + Intronic
910043703 1:82886603-82886625 ATCTTAAAAATAAGGGCAAAGGG - Intergenic
910336283 1:86135341-86135363 ATATTAATCTTAAGTGTAAATGG - Intronic
910512189 1:88019735-88019757 ATAGTATTTTTGAGGACAAAAGG + Intergenic
910676874 1:89823374-89823396 ATATAAAAATTAAGGGAAAAGGG - Intronic
912785207 1:112596133-112596155 ATGTTTATATTAATGGCAAAAGG - Intronic
913223532 1:116678746-116678768 ATATTATAAGTGAGGGGAAAAGG - Intergenic
914266339 1:146041370-146041392 ATATGATTATAAAGTTCAAAAGG + Intergenic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
917292036 1:173480101-173480123 ACTTTACTATGAAGGGCAAAAGG - Intronic
917452036 1:175155352-175155374 TTATTATTATTAAGGGTTGAAGG - Intergenic
917525436 1:175784331-175784353 ATACTATTCTCAAGGGCAAATGG - Intergenic
917553887 1:176064309-176064331 ATATTATTTTTAAAGGCTAATGG + Intronic
918003534 1:180520729-180520751 AGAATATTATGAAGAGCAAAGGG - Intergenic
918366106 1:183809528-183809550 ATGTTATTGTAAAGGGAAAATGG - Intronic
918482026 1:184988880-184988902 AGATTAGTAATAAGAGCAAAAGG - Intergenic
919329453 1:196151568-196151590 ATATTATTATTTTGGAAAAACGG - Intergenic
919438934 1:197602141-197602163 TTATTCTTATTAAAGTCAAATGG + Intronic
920268485 1:204744885-204744907 ATATTATAATTAAGAGAAAATGG + Intergenic
920586677 1:207170636-207170658 ATTTTTTTTTTAAAGGCAAAAGG + Intergenic
922027748 1:221767522-221767544 ACATTATTTTTAAGTGCACATGG - Intergenic
922397345 1:225215887-225215909 ATATTAATCTTAAATGCAAATGG - Intronic
924051075 1:240080191-240080213 AGTTTATTGATAAGGGCAAATGG - Intronic
924067495 1:240240069-240240091 ATATAATTAATATGGGCAGACGG - Intronic
924207515 1:241728401-241728423 ATATTATTATTTACAGAAAAGGG + Intronic
924706738 1:246508422-246508444 ATGTCATTATTAAGGGCAGCTGG + Intergenic
924726284 1:246674250-246674272 TTACTATTATAATGGGCAAAGGG + Intergenic
1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG + Intronic
1063400436 10:5738869-5738891 ATGTTCTGATTAAGGGCATATGG + Intronic
1064200377 10:13279409-13279431 ATTATTTTATTAAGGGCAGAGGG - Intronic
1064668357 10:17681517-17681539 ATATTATTCTCAAGGGCATATGG - Intronic
1067964725 10:50897979-50898001 ATATTAATAATAAGGGAAACAGG - Intergenic
1068365586 10:56045183-56045205 TTACTATTATTAAGTGGAAATGG - Intergenic
1068769388 10:60803919-60803941 ATCTTTATTTTAAGGGCAAAAGG - Intergenic
1069309807 10:67020316-67020338 ATTATATTATTAAGAGCACAAGG + Intronic
1071204101 10:83254292-83254314 ATATTATCTATAAGAGCAAATGG + Intergenic
1071210951 10:83341364-83341386 ATATTAATCTTAAATGCAAATGG - Intergenic
1072956170 10:99890079-99890101 ATATAAATATTAAAGACAAAAGG - Intronic
1073383246 10:103098209-103098231 ATGTTAATATTAAGGGAAACTGG - Intronic
1073962588 10:108950681-108950703 ATATTAATATTAAATGTAAATGG + Intergenic
1074956520 10:118396291-118396313 ATATTGTTACTATTGGCAAATGG + Intergenic
1075827026 10:125366785-125366807 ATATTCTTTTTAAGTGCGAATGG + Intergenic
1076047450 10:127305946-127305968 ATATTATTATTAGAGGCTGAGGG + Intronic
1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG + Intergenic
1077263385 11:1635597-1635619 ATACTATTATAAGGAGCAAAGGG + Intergenic
1079307423 11:19335695-19335717 ACATTATTGGTGAGGGCAAAAGG - Intergenic
1079674255 11:23204153-23204175 AAATCATTATTAAGCTCAAATGG + Intergenic
1080068988 11:28056239-28056261 AAATTGTTATTAAGCACAAAGGG - Intronic
1080087156 11:28297357-28297379 ATTTTAATATTTTGGGCAAAAGG + Intronic
1080380893 11:31771442-31771464 ATTTAATTCTTAAGGGCAAGGGG - Intronic
1080440558 11:32290293-32290315 ATCTTTTTACTAAAGGCAAATGG - Intergenic
1080836070 11:35942477-35942499 ATATTATTATCAAAGGCAGGAGG + Intergenic
1081161694 11:39757175-39757197 ATATTAATTTTAAATGCAAATGG + Intergenic
1085389937 11:76177159-76177181 TTATTATTATTATTGGAAAAGGG + Intergenic
1085559077 11:77453651-77453673 ATATTAGTTATAAGAGCAAAAGG + Intronic
1085996876 11:81928169-81928191 ATATTAATATTAAGCTGAAAAGG + Intergenic
1086239164 11:84668719-84668741 AAATTATTACTAAGGGGAAATGG - Intronic
1086326312 11:85704060-85704082 ATATTTATATTAAGTGCAAATGG + Intronic
1087864043 11:103201157-103201179 AAATTATTTTTAAGGAAAAAAGG + Intronic
1089778157 11:120853740-120853762 ATATTATTATGAAGCTGAAAAGG - Intronic
1090870422 11:130740580-130740602 ATATTATTATGTAGGCTAAAGGG - Intergenic
1090994267 11:131851146-131851168 ATATAATTATTGGGGTCAAATGG + Intronic
1091718703 12:2796750-2796772 TTATTATTATAATCGGCAAAGGG - Intronic
1091939395 12:4463670-4463692 TCATTATTTTTAAGGGCACATGG + Intergenic
1091971555 12:4791633-4791655 ACATTATTCATAAAGGCAAATGG + Intronic
1092175397 12:6401646-6401668 ATATTAACATTAAGGGCAGCTGG - Intergenic
1092552455 12:9518011-9518033 ATATTATTATTAGGAACAACCGG - Intergenic
1093174510 12:15897435-15897457 ATATTATTATTAATTGCTGAAGG - Intronic
1093175647 12:15911083-15911105 ATATTTTTATTACGTGCAATTGG + Intergenic
1093253496 12:16837541-16837563 AAAAGAATATTAAGGGCAAAGGG - Intergenic
1093787626 12:23211038-23211060 ATATTATTTTACAGGACAAAAGG - Intergenic
1094082267 12:26550810-26550832 ATATTATTATGAATGGAAACTGG - Intronic
1094264062 12:28535602-28535624 GTAATATTAATAAGGGCAAAGGG - Intronic
1094519667 12:31172601-31172623 ATATTATTATTAGGAACAACTGG + Intergenic
1097430925 12:59505895-59505917 ATTTTATTAGAAAGTGCAAAAGG - Intergenic
1097462556 12:59880334-59880356 ATATTATTTTTAAAGGAAAGAGG - Intergenic
1097647495 12:62253780-62253802 ATATTACTTTAAATGGCAAAAGG - Intronic
1097798513 12:63888311-63888333 TTAATACTATTAAGGGCAAAAGG - Intronic
1098020307 12:66148849-66148871 ATACTGTAATTAAGGGGAAAGGG - Intronic
1098346714 12:69512948-69512970 ACTTTATTTTGAAGGGCAAAAGG + Intronic
1098934254 12:76459781-76459803 TGATTATTATGAAAGGCAAATGG - Intronic
1099238717 12:80114104-80114126 ATATTAAAATTAAAGGTAAATGG - Intergenic
1099344801 12:81485065-81485087 AAATTATTTTTAAGGCCAAAAGG + Intronic
1100318659 12:93468733-93468755 TTATTATTATTAATGGCTCAGGG + Intronic
1103251150 12:119501023-119501045 ATAATAATAATAATGGCAAAAGG + Intronic
1104526882 12:129532409-129532431 CTATTAATATTAGGGACAAAAGG + Intronic
1106094037 13:26626748-26626770 AGATTATTATTAGGGGTAAATGG + Intronic
1106291267 13:28365018-28365040 ATATTATAATTTGGGGGAAATGG + Intronic
1106860915 13:33907346-33907368 TTATTATTTTTAAGAACAAATGG - Intronic
1107245146 13:38285293-38285315 ATATTAATATTAGGAGCAAAGGG + Intergenic
1107719496 13:43232962-43232984 ATATTGTTATAAAGGAAAAATGG - Intronic
1108751748 13:53454725-53454747 ATATTATTTTTTATGGCAAAAGG + Intergenic
1108793856 13:54006756-54006778 ATAATAATAACAAGGGCAAATGG + Intergenic
1108852560 13:54751242-54751264 ATGTTAATATTAAGAGGAAAGGG + Intergenic
1109019719 13:57073608-57073630 ATATTATTAATCAGAGAAAAGGG - Intergenic
1109098569 13:58148712-58148734 ATATTAATAATAAGGGAAACTGG - Intergenic
1109170123 13:59084701-59084723 ATATTAATATTCAAGGAAAAGGG + Intergenic
1109434982 13:62287122-62287144 ATATTAGTATTTAGGGGCAAAGG + Intergenic
1109550600 13:63893782-63893804 ATATTATGATTATGGACAGAAGG - Intergenic
1109671863 13:65619321-65619343 AGAGTATTTTAAAGGGCAAAAGG + Intergenic
1109804642 13:67422438-67422460 ATACTATTATTAATCACAAAGGG - Intergenic
1110638506 13:77793459-77793481 ATATTAATATTAAAAGCAAATGG + Intergenic
1110870505 13:80447255-80447277 ATATTATGATTAGGGGAAACTGG + Intergenic
1111837292 13:93403725-93403747 ATATTGTTTTTAAAGGCAATTGG + Intronic
1111860563 13:93699543-93699565 ATAATATTTATATGGGCAAAAGG - Intronic
1112422993 13:99270277-99270299 ATATTTTTATCAAGGGCATATGG + Intronic
1113284335 13:108829788-108829810 ATCCTTTTATTAAGGTCAAAAGG - Intronic
1113364859 13:109666568-109666590 ATATTATTATTAATAGCAATAGG - Intergenic
1114176065 14:20321195-20321217 ATATTATAATTAAGGAGAAAAGG + Intronic
1115085637 14:29512166-29512188 AAATTTCCATTAAGGGCAAACGG + Intergenic
1115167940 14:30470838-30470860 ATTTTATTTTTAAAGGAAAAAGG - Intergenic
1115787172 14:36838831-36838853 AAATTCTTATTAAGGGAGAAAGG - Intronic
1116673637 14:47876473-47876495 ATGTTAAAATTAAGGGAAAAAGG - Intergenic
1116813002 14:49557062-49557084 ATATTCTTATTTAAGGTAAAGGG - Intergenic
1116963828 14:50993996-50994018 ATGTTATTATCCATGGCAAAAGG + Intronic
1117310284 14:54515038-54515060 ATATTATTTTTAAGTGCATTAGG - Intronic
1117527808 14:56628812-56628834 ATATTTATATTAAATGCAAATGG - Intronic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1117693359 14:58333042-58333064 AAATTAATATTAAGTGGAAAAGG - Intronic
1118681567 14:68246767-68246789 ATATTACTAAAAAGAGCAAAGGG + Intronic
1120224946 14:81780226-81780248 ATATTTATATTAGGGGAAAATGG - Intergenic
1120270370 14:82306117-82306139 ATAATAGAAATAAGGGCAAATGG + Intergenic
1120491785 14:85187390-85187412 AAATTATTATTAAATCCAAATGG - Intergenic
1120778391 14:88462883-88462905 ATATTATAAATAGGGACAAACGG - Intronic
1121960405 14:98254308-98254330 ATGTTATTCTTAAGAGGAAAAGG + Intergenic
1122011586 14:98753542-98753564 ATAGTAATAGTAAGGGCAATAGG + Intergenic
1123917234 15:25044120-25044142 ATATTATTTTCAAGTGCACATGG - Intergenic
1123978392 15:25574864-25574886 ATATTATTATTAAACATAAATGG - Intergenic
1124528635 15:30482559-30482581 ATATTATTCTTAATGTCGAAAGG - Intergenic
1124549873 15:30670050-30670072 TTATTATTATTATTGGCAAGAGG - Intronic
1124770021 15:32525138-32525160 ATATTATTCTTAATGTCGAAAGG + Intergenic
1125113105 15:36057094-36057116 ATATTATTTTCAAGTGCACATGG + Intergenic
1126212016 15:46110707-46110729 ATATTAGTAGTAAGGGAAACTGG - Intergenic
1126948445 15:53851928-53851950 GTATTATTACAAAGGACAAAAGG - Intergenic
1127060840 15:55182218-55182240 TTATTTTTATTAAAGGCAAAGGG - Exonic
1127603830 15:60566342-60566364 AAAATGTTATTAACGGCAAAAGG - Intronic
1130950084 15:88579320-88579342 ATTTTGTTAATAAGGGGAAAAGG + Intergenic
1131368321 15:91858416-91858438 TAATAATTATTAAGGGAAAAAGG + Intronic
1133918766 16:10133150-10133172 ATGTTATGATTTATGGCAAAAGG - Intronic
1134349236 16:13421090-13421112 ATATTTTTATTGAAGGGAAAGGG - Intergenic
1135880944 16:26256068-26256090 ACATTATTTTAAAGGGCACATGG + Intergenic
1135882774 16:26275270-26275292 AGACTATTGTTAAAGGCAAAGGG + Intergenic
1136040331 16:27573746-27573768 CTATTATTATAATGGGAAAATGG - Intronic
1137543358 16:49379720-49379742 ATGTTAACATTAAGGGAAAATGG + Intronic
1138782539 16:59806615-59806637 ATATTATACTTAAAGACAAATGG + Intergenic
1139497798 16:67333857-67333879 ATATTAAAATTAAGGGAAACGGG - Intronic
1139841123 16:69881579-69881601 ATAGTATTATTAAGGGAAACTGG + Intronic
1143267437 17:5650522-5650544 ATATTATTTTTAACTACAAATGG - Intergenic
1143859035 17:9874484-9874506 TTATTATTATTAAAGAAAAAGGG - Intronic
1144242847 17:13331011-13331033 AAATGATTATTAAAGGCACATGG - Intergenic
1144444232 17:15311969-15311991 ATATTATTATTAAAGTTTAATGG - Intronic
1145803386 17:27706715-27706737 ATATCATTTTTTAGGGCAAAAGG + Intergenic
1146246780 17:31292363-31292385 TTCTTATTATTAATGGAAAAAGG - Intronic
1146815828 17:35941644-35941666 TTATTATTATTATGGGCTCATGG - Intronic
1146820346 17:35979675-35979697 TTATTATAATTAAGAGCCAATGG + Intronic
1148866113 17:50629592-50629614 ATATTATTATTAAGATCCAGCGG - Intergenic
1149774675 17:59347966-59347988 CTATTATTTTTAATGGCCAATGG - Intronic
1155051353 18:22150548-22150570 ATATTATACCTAATGGCAAAAGG + Intergenic
1155670753 18:28368217-28368239 ATAGTATTATTAGGTGCAAAAGG - Intergenic
1156346308 18:36260099-36260121 ATATTATTATCAATGGAAAAAGG + Exonic
1156542871 18:37933393-37933415 AAATTATTTTTAAGTGCATATGG + Intergenic
1157150364 18:45210998-45211020 ATTTTATTACTAAAGGCAACAGG + Intergenic
1157378186 18:47185456-47185478 ATAGTATTATAATGAGCAAAGGG + Intergenic
1157509200 18:48256699-48256721 ATATTATCATTAAGGTCAAAAGG + Intronic
1157853323 18:51079629-51079651 ATATGATCATTGATGGCAAAGGG - Exonic
1157986003 18:52437995-52438017 ATATTAGTATTAAGAGCCAATGG + Intronic
1158448952 18:57546471-57546493 ATATTATTATTACCCACAAAGGG - Intergenic
1158946665 18:62453045-62453067 ATATGATAATTAAGGTGAAAAGG - Intergenic
1159225337 18:65526384-65526406 ATATTATTATTACAAGGAAAAGG - Intergenic
1159316486 18:66780809-66780831 TCATTATTATTAAAGGCAAATGG - Intergenic
1159961912 18:74561765-74561787 TAATTATTATTAAGGACAATGGG + Intronic
1160236278 18:77088781-77088803 ATATTATTTTTGGGGGAAAAGGG - Intronic
1160306098 18:77738491-77738513 ATTTTATTATTAAAGACAATTGG - Intergenic
1162556197 19:11387477-11387499 AAATTGTTATGAATGGCAAACGG + Intronic
1164993415 19:32701106-32701128 ATATTCTTCTTAGGTGCAAAGGG - Intronic
1165597854 19:37026012-37026034 ATCTTATTAATAATGGCATAAGG + Intronic
1168318816 19:55496471-55496493 ATATTATTATTCAGGAAAAGGGG - Intronic
926508805 2:13747308-13747330 ATATTAACATTAAGTGTAAATGG + Intergenic
927348160 2:22071648-22071670 ATATAATGATAAAGGGAAAAGGG + Intergenic
927831503 2:26354834-26354856 AAATTATTAGTAGGGGCAAGCGG + Intronic
928251614 2:29686086-29686108 ATATTACTTTATAGGGCAAAAGG - Intronic
928829385 2:35461074-35461096 ATATGATTATGAATGACAAAGGG - Intergenic
929176463 2:38982160-38982182 CTATTTTCATTAAAGGCAAAAGG + Exonic
930381062 2:50629823-50629845 AGATTACTCTTAAGAGCAAATGG - Intronic
930734440 2:54761901-54761923 GTTTTAGTATTAAGGGTAAAAGG - Intronic
931056295 2:58475472-58475494 ATTTTGTTATTAAGAGAAAAGGG - Intergenic
931875561 2:66508044-66508066 ATATTATTTGAAAGGGCAAATGG + Intronic
932101057 2:68899563-68899585 AAATTCTTAGTAAGTGCAAAGGG + Intergenic
932472527 2:71970409-71970431 ATATTATTTTTAACAGCAATAGG - Intergenic
933534877 2:83558969-83558991 AAAGTATTAACAAGGGCAAATGG + Intergenic
933595525 2:84279313-84279335 TAATTGTTATTAATGGCAAAGGG - Intergenic
933812413 2:86041016-86041038 ATATTTTTAGTTAGTGCAAATGG + Intronic
934138922 2:89026139-89026161 ATATTAATATTAAGAATAAAAGG - Intergenic
934230327 2:90174421-90174443 ATATTAATATTAAGAATAAAAGG + Intergenic
935406364 2:102714156-102714178 ATAATATTATTAAGTGGAAATGG - Intergenic
935612784 2:105043329-105043351 ATACTACTATGAAGGGGAAACGG - Intronic
935859868 2:107317618-107317640 ATATTATTTTAATGGGGAAAAGG + Intergenic
936402340 2:112174933-112174955 ACATGATTATTATGGGAAAAGGG + Intronic
936804581 2:116313780-116313802 ATATTATTAGGAAAGGCAAAGGG - Intergenic
939261339 2:139814126-139814148 ATATTATATTTAAGGGCTACAGG - Intergenic
939261674 2:139818682-139818704 TTTTTATTAGTAAGGACAAATGG - Intergenic
940031406 2:149265951-149265973 ATATTTTAAATAAGTGCAAAGGG - Intergenic
941205422 2:162566505-162566527 ATATGATCATTAAGTGCAAGAGG + Intronic
941835908 2:170020256-170020278 AAATTATTATAATGGTCAAAAGG + Intronic
942174132 2:173314843-173314865 ACATTATTTTCAAGTGCAAATGG - Intergenic
942265501 2:174220322-174220344 AGATTATTATTCAGAGTAAATGG - Intronic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
942823455 2:180144256-180144278 ATACCATTTTTAAGGGGAAATGG + Intergenic
942957891 2:181795372-181795394 ATATTAATAATAAGGGAAACTGG + Intergenic
943169846 2:184384803-184384825 ATGTTGTAATTCAGGGCAAAAGG - Intergenic
943625462 2:190194187-190194209 ATATTCTTATCAAGTGCATATGG - Intronic
943919527 2:193686032-193686054 GTTTTATTTTTAAGGACAAATGG + Intergenic
943936439 2:193921911-193921933 AGATTATTATTATGGATAAATGG - Intergenic
944453462 2:199868942-199868964 ATGTTACTATGTAGGGCAAATGG - Intergenic
945828863 2:214758783-214758805 ATATTATTACTGAGGGGAAAAGG - Intronic
945854688 2:215054848-215054870 ATATTTTTATTCAGAGAAAATGG + Intronic
946482036 2:220066448-220066470 ATATTATTATTTCTTGCAAATGG + Intergenic
947386884 2:229599329-229599351 ATATTAGTATTAAAGGAAGAGGG + Intronic
947648338 2:231762045-231762067 ACATTGTTAGGAAGGGCAAAAGG - Intronic
948437771 2:237965871-237965893 TTATTATTATTATGGGGACAGGG + Intergenic
1169569830 20:6893650-6893672 AGATGTTTATTACGGGCAAATGG + Intergenic
1173096339 20:40032620-40032642 ATATTATCATTAAGCCCACAGGG - Intergenic
1173330319 20:42070758-42070780 ATAAAATTATTTAAGGCAAAAGG - Intergenic
1174074673 20:47925036-47925058 ATCTTCTTATTAAAGGCTAATGG - Intergenic
1174281095 20:49439890-49439912 AAATTTTTTTTAAGGGCAAAGGG - Intronic
1175036968 20:56008704-56008726 CTATCATTATAAAGAGCAAAGGG - Intergenic
1175548570 20:59799787-59799809 AAATAATCATTAAGTGCAAATGG - Intronic
1177377615 21:20293631-20293653 ATATTATTCAGAAGGGAAAAAGG - Intergenic
1177458416 21:21375546-21375568 AAAAAATTATTAAGGGAAAAAGG - Intronic
1178335766 21:31741624-31741646 ATATTATTTTAAAGTGCACATGG - Intergenic
1182612692 22:31562551-31562573 ATATTATTGTTAAGGGAACCAGG + Intronic
1182859614 22:33547848-33547870 ATATTAATAATAAGGGGAACAGG + Intronic
1184319795 22:43732184-43732206 CTACAATTATTAAAGGCAAATGG - Intronic
949325562 3:2859720-2859742 ATATGATTTTTAAAGGCAAATGG - Intronic
949674662 3:6439528-6439550 TTATTTTTATTAAGAGCAGATGG + Intergenic
950281599 3:11712515-11712537 AAATTATTACTTAGGCCAAATGG + Intronic
951431282 3:22610094-22610116 ATATTATAATTTAGTACAAAAGG - Intergenic
952403323 3:32983651-32983673 TTATTATTTTCAAGGTCAAAGGG - Intergenic
952854568 3:37758464-37758486 ATATTATTATTAATAATAAAAGG + Intronic
953010773 3:39023532-39023554 ATATTATTTTTAAAGAGAAAAGG - Intergenic
953294432 3:41699466-41699488 AAAATATTATTAATAGCAAAGGG - Intronic
953310439 3:41872649-41872671 TTATTATTATTATTGGCAAGAGG + Intronic
953873594 3:46649178-46649200 CTATTATTATTTTGGACAAATGG - Intergenic
955848515 3:63194378-63194400 ATATTAGTCTTTATGGCAAATGG - Intergenic
955886781 3:63607963-63607985 AGGTTATTATTAAGAACAAAAGG + Intronic
956010410 3:64824914-64824936 AGATTATCTTTAAGGGGAAACGG - Intergenic
956046144 3:65198142-65198164 ACATTGTTATTGAGAGCAAATGG - Intergenic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
956532103 3:70232011-70232033 ATATGCTTATTAATGGCTAAGGG - Intergenic
957159056 3:76584769-76584791 ATATTATTATCAAGGCCAGGTGG - Intronic
957612575 3:82487226-82487248 GTATTAATACTAAGGGAAAAGGG - Intergenic
958055135 3:88400452-88400474 ATATTATCATACATGGCAAAAGG + Intergenic
958947826 3:100383722-100383744 AAGTTATTATTAAAGGAAAAAGG + Intronic
959822261 3:110750190-110750212 ATTTTATTCTAAAGGGAAAAAGG + Intergenic
960014748 3:112874185-112874207 ACATTATTCTTAAGTGCACATGG - Intergenic
961589386 3:127964726-127964748 ATATTGTTTTTAATGGCAAGAGG + Intronic
961964179 3:130885325-130885347 ATAATAACATTAAGTGCAAATGG - Intronic
962188242 3:133282657-133282679 ATAAAATTATGATGGGCAAATGG - Intronic
962807817 3:138939436-138939458 TTATTATTACTAAGGACAACCGG + Intergenic
963008313 3:140747044-140747066 ATATTATCATGTATGGCAAAAGG - Intergenic
965000783 3:162950007-162950029 ATATTAATATTGAATGCAAATGG + Intergenic
965116574 3:164497267-164497289 ATGTTATTATTAAAGATAAAAGG - Intergenic
965301713 3:167012751-167012773 ATATTATTTTTAAAGGGGAATGG - Intergenic
965486303 3:169282664-169282686 ACATTCTTAATGAGGGCAAAGGG - Intronic
965690773 3:171354552-171354574 ATCTTATGATTATGAGCAAATGG + Intronic
965843343 3:172932805-172932827 AAATTATAATGAAGGTCAAAGGG - Intronic
965845535 3:172956844-172956866 ATATTGTTATTGATGCCAAATGG - Intronic
966127549 3:176597224-176597246 TTACTATTATTAAGTGAAAATGG - Intergenic
966998077 3:185304259-185304281 ATATTCTTCTCAAGGGCATATGG - Intronic
967841835 3:194011342-194011364 AAATTCTTATTAACGACAAAGGG + Intergenic
969117522 4:4880644-4880666 ATATCATTTTAAAGGTCAAATGG + Intergenic
970712979 4:18885883-18885905 TTATTATTATTAATGACACAGGG - Intergenic
970903464 4:21187377-21187399 TAATGTTTATTAAGGGCAAAGGG + Intronic
971401578 4:26280583-26280605 AATTTATTATTAAAAGCAAATGG + Intronic
971619542 4:28837855-28837877 ATATTATTCTTAAGTGCAACTGG - Intergenic
971852409 4:31999166-31999188 ATTTTATTATTAAGAGGAAAGGG + Intergenic
972493965 4:39615245-39615267 ATATTAATATTAAGGGAAGCGGG + Intronic
972974534 4:44617568-44617590 AGATTATTGCTAAGGGTAAATGG - Intergenic
974326101 4:60417362-60417384 ATATTAATATTAAACGTAAATGG - Intergenic
974519315 4:62960736-62960758 TTACTATTATTATGAGCAAAGGG + Intergenic
974601078 4:64080320-64080342 ATATAATTATAAAGGCCAAGTGG + Intergenic
974918841 4:68211340-68211362 ATATTATTAATTAAGGTAAAGGG + Intergenic
975240897 4:72057744-72057766 ATATACTTATTAAGTGCCAAGGG + Intronic
975482149 4:74892589-74892611 ACATTAATTTCAAGGGCAAATGG + Intergenic
976928592 4:90533944-90533966 GTATTATTCTGAAGGGTAAATGG - Intronic
976949084 4:90807271-90807293 ATATTACTGTTAATGGTAAAAGG - Intronic
977153120 4:93538991-93539013 ATATTAATATTAGGGGAAAATGG + Intronic
977994676 4:103486907-103486929 ATATTAGACTTAAAGGCAAATGG + Intergenic
978702154 4:111660484-111660506 ATATTAATACTAAGGTCAAGAGG + Intergenic
978899698 4:113932404-113932426 ATATTATTTTCAACAGCAAATGG + Intronic
979148432 4:117276423-117276445 ATATTATTTTAAAAGGCATATGG + Intergenic
979383768 4:120039930-120039952 ATATTATCATTAAAGGAAACTGG - Intergenic
979393116 4:120150475-120150497 TTACTCTTATTAAAGGCAAATGG - Intergenic
979400171 4:120239434-120239456 ATATTATTATTAAGTGCTTGTGG + Intergenic
979510779 4:121551136-121551158 ATATTCTTTTTAAGTGCACATGG - Intergenic
979566905 4:122164601-122164623 AAATAATTATTAATGACAAAGGG - Intronic
980306015 4:131062488-131062510 ATATGTTTATTAATGGAAAAGGG - Intergenic
980340535 4:131539779-131539801 ATATTATCATATATGGCAAAAGG - Intergenic
980433570 4:132737972-132737994 AAATTATTTTAAAGTGCAAATGG + Intergenic
980505441 4:133713720-133713742 ATATTATTATTAATTGAACAGGG + Intergenic
980816960 4:137960457-137960479 ATATTAAAATAAAGGGCAAAGGG - Intergenic
981095925 4:140781671-140781693 ATATAAATATTAACGGCCAAAGG - Intergenic
981783095 4:148447137-148447159 ATACTGTAAATAAGGGCAAATGG - Intergenic
981965157 4:150591504-150591526 ATATTTGTATAAAGGACAAAAGG - Intronic
982924645 4:161320389-161320411 ATATTCTTGTCAAGGGAAAAGGG + Intergenic
983486640 4:168339726-168339748 ACATTATTACTAAGTGAAAAAGG - Intergenic
983719801 4:170836306-170836328 ATATTTTGATTGAGGGAAAATGG - Intergenic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
986240164 5:5953680-5953702 CTATTATTAATAATGGCCAAGGG + Intergenic
986739931 5:10697019-10697041 AGGTTATCATTAAGGGCAAGGGG + Intronic
986993602 5:13580652-13580674 CTATTATTAGAAAGGGCTAAGGG - Intergenic
987277362 5:16375813-16375835 ATATTATTATTAGGGGAACAAGG + Intergenic
987463223 5:18240104-18240126 ATATTATTTTCAAGTGCACATGG - Intergenic
987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG + Intergenic
987837206 5:23177314-23177336 ATATTATGCTTAAAGGTAAATGG - Intergenic
987876329 5:23686206-23686228 ATTTTATTATTAAATGCACAGGG + Intergenic
988085856 5:26474807-26474829 ATATTATTATGAAGACCAAAAGG + Intergenic
988176857 5:27738662-27738684 ATATTATTATGCAGAGGAAAAGG - Intergenic
988879955 5:35491067-35491089 ATATCAGTATTAAGGACAATAGG - Intergenic
989436724 5:41422123-41422145 ATATTATTGTAAAGGGCTATTGG + Intronic
989682239 5:44043066-44043088 ATATTATTGTTAAATGTAAATGG + Intergenic
990351108 5:54917789-54917811 ACATTATTCTTAAGTGCACATGG - Intergenic
990369107 5:55098671-55098693 ATATTAATCTTAAGTGTAAATGG + Intergenic
991092684 5:62708229-62708251 ATATTATTATCAAAAGTAAAAGG - Intergenic
991368638 5:65895213-65895235 TTATTATTATTAAGGATTAAGGG + Intergenic
991611625 5:68455558-68455580 ATATCATTTTTATGGGCAACTGG - Intergenic
992269088 5:75047625-75047647 AAATTGTTTTTAAAGGCAAAAGG - Intergenic
992352588 5:75945626-75945648 ACATTATTTTTAAGTGCACATGG + Intergenic
992518173 5:77518435-77518457 TTATTATTCTGCAGGGCAAATGG + Intronic
992525475 5:77605801-77605823 ATATTTTTTTTAAGCACAAAGGG - Intronic
993394140 5:87361564-87361586 ATTTTACTATTAAGGTCAATTGG - Intronic
994069324 5:95580952-95580974 AGATTATGGTTAAAGGCAAAAGG - Intronic
994340847 5:98625936-98625958 ATATTATCAATAAGGGCAACAGG - Intergenic
995197581 5:109390031-109390053 ACATTATTTTTAAGTGCATATGG - Intronic
995340710 5:111056108-111056130 ATATTAAACTTAAGTGCAAATGG - Intergenic
995739637 5:115341893-115341915 ATATTGTGATTAAGGGCCAGGGG + Intergenic
996145725 5:119972929-119972951 ATATTATTATTTAGTTGAAATGG + Intergenic
996426994 5:123324449-123324471 ATATTTTTCTTAAGTGCACATGG - Intergenic
996710368 5:126537392-126537414 ATATCATTGGTATGGGCAAACGG + Intergenic
997004396 5:129801713-129801735 ATATTAATCTTAAAGGTAAATGG - Intergenic
997141237 5:131382915-131382937 ATATTATTAAGAAGAGAAAAAGG + Intronic
1000212922 5:159125181-159125203 ATATTATTTTCAAGTGCACATGG - Intergenic
1000593563 5:163187313-163187335 AAATTATTATTTAAGGAAAATGG + Intergenic
1002039709 5:176503852-176503874 TTTTTATTACTAATGGCAAAGGG - Intronic
1002556821 5:180048369-180048391 ATATTATTATCAAAGGCTACAGG + Intronic
1003091982 6:3112057-3112079 TTATTTTTATGAAGGGCGAAGGG + Intronic
1003685332 6:8296793-8296815 ACATTATTAGGAAGGGGAAATGG + Intergenic
1003971207 6:11301016-11301038 ATATTAATCTTAAGTGAAAATGG + Intronic
1004823532 6:19396139-19396161 ACATTATTTTTAAGGGCCATAGG + Intergenic
1006957852 6:37892036-37892058 ACATTATTCTTAAGGGCACATGG + Intronic
1007861698 6:44916556-44916578 ATATTATTACTAACTGAAAATGG + Intronic
1008146686 6:47900060-47900082 ATATTATTCATAATGGCAAAAGG - Intronic
1008279549 6:49579541-49579563 ATAGTATTCTTAAGAACAAAAGG - Intergenic
1008464008 6:51810040-51810062 ATATTATAATTAAGTGTGAAAGG - Intronic
1009347502 6:62634289-62634311 ATATTCTCATTTAGGGCAACAGG - Intergenic
1009572220 6:65400489-65400511 ATGTTATTATTATGAGCAGAAGG - Intronic
1009578659 6:65501852-65501874 ATATTATTATTAAACAGAAATGG + Intronic
1010910251 6:81545546-81545568 ATATTATTTTCAAGTGCACATGG + Intronic
1011357140 6:86483292-86483314 TTATTATTATTTAGTGGAAATGG + Intergenic
1011542583 6:88448026-88448048 ATATTTTTAAAATGGGCAAATGG + Intergenic
1011744080 6:90392234-90392256 ATATATATATCAAGGGCAAAAGG - Intergenic
1011803139 6:91041080-91041102 ATAATATCAGTAATGGCAAATGG - Intergenic
1012026294 6:93996832-93996854 ATTATATTAATAAGGGCAGAGGG - Intergenic
1012046859 6:94286929-94286951 ATGTTACTACTAAAGGCAAAAGG - Intergenic
1012121151 6:95367995-95368017 ATATTATTTTAAATGGCAAAAGG + Intergenic
1012745660 6:103084011-103084033 ATATTACTATTGAGAACAAAAGG - Intergenic
1012863865 6:104594924-104594946 ATATTATTTTACATGGCAAAAGG - Intergenic
1013068525 6:106706590-106706612 ATATTATTCTAAATGGCAAAAGG - Intergenic
1013487555 6:110611834-110611856 AAATTATTACTAAGGGTAAAGGG + Exonic
1013722506 6:113047726-113047748 ATAAAATAATTAAGTGCAAAAGG + Intergenic
1014970206 6:127804854-127804876 AAACTTTTATTAAGGACAAATGG + Intronic
1015517450 6:134098109-134098131 ATATTATTATAGAAGACAAATGG + Intergenic
1016039700 6:139420143-139420165 TTATTATTATTTAGAGTAAACGG + Intergenic
1016052194 6:139541374-139541396 ATACTAATATTAATGGCAAGGGG - Intergenic
1016790549 6:148063016-148063038 ATATTAATCTTAAATGCAAATGG - Intergenic
1017223470 6:151993054-151993076 ATAAAATTATGAAGAGCAAAAGG + Intronic
1017322858 6:153113071-153113093 ATATTAATCTTAAAGGTAAATGG + Intronic
1018528580 6:164739606-164739628 ATATTATTAAGGAGGGCAATTGG + Intergenic
1019020739 6:168915490-168915512 TTATGATTATAAAGAGCAAAGGG + Intergenic
1019089393 6:169514991-169515013 ATATTAGTATTAAATGCAAGTGG - Intronic
1020346556 7:7171053-7171075 ATATTTTTCTCAAGGGCACATGG - Intronic
1020514345 7:9097389-9097411 ATCTTGTTATTAAAGGCTAAAGG + Intergenic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1020908202 7:14092778-14092800 ACATTATTCTTAAGGATAAAAGG - Intergenic
1021556956 7:21929455-21929477 ATATTAATCTTAAGTGTAAATGG + Intronic
1022125632 7:27353641-27353663 ATCTTACTGTTGAGGGCAAAAGG - Intergenic
1024014437 7:45298599-45298621 ATATTTTTATCAAGTGCACATGG + Intergenic
1024485569 7:49914244-49914266 GAATTATTATTAAGGGAAACAGG - Exonic
1024637702 7:51303961-51303983 ATATTATTTTTAATGGGTAAAGG + Intronic
1024701090 7:51905042-51905064 ATATAATTTTTAAGGCCATAAGG - Intergenic
1024765464 7:52652604-52652626 ATATGAATATTAAGGACAATTGG + Intergenic
1025582731 7:62740769-62740791 ATATTATCATTAAATGTAAATGG - Intergenic
1026083953 7:67247225-67247247 ACATTATTCTCAAGGGCACATGG + Intergenic
1026182245 7:68051821-68051843 ACATAAATATTAAGGGGAAAGGG + Intergenic
1026693079 7:72566802-72566824 ACATTATTCTCAAGGGCACATGG - Intronic
1028282579 7:88949241-88949263 AAATAATTATCAAGCGCAAATGG - Intronic
1028347475 7:89799943-89799965 ATATTATCATGAAGGTCAGAGGG + Intergenic
1028445488 7:90917501-90917523 GTATTAATATTTAGGGAAAATGG - Intronic
1030067246 7:105669452-105669474 AAACTTATATTAAGGGCAAAGGG - Intronic
1030605541 7:111635374-111635396 ATATTATTAAGTAGGGGAAAAGG - Intergenic
1030842813 7:114377081-114377103 ATATTATTATTAATGGAGGAAGG + Intronic
1031121108 7:117723593-117723615 ATCTTATTATCAATGCCAAAAGG + Intronic
1031317772 7:120277390-120277412 AGATCCTTATTAAGGACAAATGG + Intronic
1031467626 7:122133168-122133190 ATATTATTTTGAAGAGCAAGTGG + Intronic
1033709520 7:143927154-143927176 ATTTTATTATTAAAGGAAAATGG + Intergenic
1034726847 7:153344140-153344162 AAAATACTATTAAGGACAAAGGG + Intergenic
1037227262 8:16607575-16607597 TTTTTATTATTAAGGGCTTATGG - Intergenic
1037245842 8:16833909-16833931 ATAGAAATATTAAGGGAAAATGG + Intergenic
1037699184 8:21257300-21257322 ATAATTATATTAAGGGTAAATGG + Intergenic
1037822693 8:22142562-22142584 ATACTACTATTAAGGGCCCAGGG - Intergenic
1038951782 8:32423171-32423193 ATATTATTGCTGAAGGCAAAGGG - Intronic
1040642629 8:49357182-49357204 AAATTATTTTTAAAGGCATAAGG + Intergenic
1041681627 8:60598818-60598840 ATGTTATACTTAAGGGCAAAAGG + Intronic
1042631630 8:70822966-70822988 GTATTATTATTAATATCAAATGG - Intergenic
1042692607 8:71518932-71518954 ATAGTATTATTTAGGAAAAAAGG - Intronic
1043061010 8:75503049-75503071 ATATTATTAGGAAGGGCAGCAGG + Intronic
1043665201 8:82801705-82801727 ATATTTTTCTTAACTGCAAATGG + Intergenic
1043782746 8:84356484-84356506 ATGTTATCATTAAAGGCAGAAGG + Intronic
1044067054 8:87711444-87711466 ATGTGATTAATAAGGGGAAATGG + Intergenic
1045310293 8:100995081-100995103 AAATTATTTCCAAGGGCAAAAGG + Intergenic
1045768881 8:105710376-105710398 ATATGCTTATTAAGAGCCAATGG - Intronic
1046025803 8:108722220-108722242 ATATTACTTTAAAAGGCAAAAGG - Intronic
1046095983 8:109561149-109561171 ATAACTTTATTAATGGCAAATGG + Intronic
1047376758 8:124306126-124306148 ATATTAATCCTCAGGGCAAAAGG + Intergenic
1048514305 8:135091943-135091965 ATAATAATAATAATGGCAAAGGG - Intergenic
1051094078 9:13445087-13445109 ATGGTATTTTTCAGGGCAAAAGG + Intergenic
1051519279 9:17966690-17966712 ATATAAATATTAAGGCCAATCGG - Intergenic
1051986238 9:23090970-23090992 AGATTATTTTTAAAGGCTAAGGG - Intergenic
1052059166 9:23939867-23939889 ATATTATTATTGAATGCAAAGGG + Intergenic
1052505370 9:29346968-29346990 ACATTGTTATAAAGAGCAAAGGG - Intergenic
1054914629 9:70484510-70484532 ATATAATTATTTAAAGCAAAGGG + Intergenic
1055329837 9:75172351-75172373 ATTTTATTTTTAAGTTCAAAGGG + Intergenic
1056527863 9:87460193-87460215 ATATATTTATTAAGTGGAAATGG - Intergenic
1056943751 9:90976545-90976567 AAATTATTCTTTAGGTCAAATGG - Intergenic
1057368318 9:94445174-94445196 ATATTTTTATTTACCGCAAAAGG - Exonic
1058616885 9:106839325-106839347 ATATTCTTATTGAGGGAGAAAGG + Intergenic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1059873623 9:118606284-118606306 ATATTATATGTAAGAGCAAAAGG + Intergenic
1186197479 X:7124094-7124116 ACATTATTCTTAAGTGCACATGG + Intronic
1186358114 X:8808634-8808656 ATGTTATTATAAAGGACAACAGG + Intergenic
1186359573 X:8826155-8826177 ATATTATTTTTAAACCCAAAAGG + Intergenic
1186604370 X:11074453-11074475 ATGTTAATATTAGGGGCAACTGG + Intergenic
1187382804 X:18820741-18820763 ATATTCTTATCAAGCACAAATGG + Intronic
1188130533 X:26425638-26425660 ATTTTATTATTAACAACAAAAGG - Intergenic
1188457430 X:30382516-30382538 ATATCATTTTTCTGGGCAAAGGG - Intergenic
1188687427 X:33085235-33085257 ATATTATTTTTATGAGAAAATGG - Intronic
1188834141 X:34935390-34935412 ATATTAACCTTAAGTGCAAATGG + Intergenic
1189224379 X:39400330-39400352 ATTTCAATATTAAGGGCAATAGG - Intergenic
1189908775 X:45788840-45788862 ATAGTATTCTTAAGAGCACAAGG - Intergenic
1190967416 X:55313782-55313804 ATATTACCATTGAGGGAAAATGG - Intergenic
1191601163 X:63009639-63009661 ATATTATTATAAAATGCAAGTGG + Intergenic
1192039356 X:67601749-67601771 CTATTATTCTTATGGGTAAAAGG - Intronic
1192907294 X:75565266-75565288 ATATTAACATTAAATGCAAATGG - Intergenic
1193234295 X:79087973-79087995 ATCTTATTATAAATGCCAAATGG + Intergenic
1194169619 X:90565189-90565211 AAATTATTGTGAAAGGCAAAGGG - Intergenic
1195227066 X:102807568-102807590 AAATTATGATTAAGAGCACAAGG - Intergenic
1195281383 X:103337764-103337786 ACATTCTTCTTAAGGGCAGATGG + Intergenic
1195686880 X:107595497-107595519 ACATTATTCTTAAGTGCATATGG - Intronic
1196075506 X:111571496-111571518 GTAGTATTAATAAGAGCAAAAGG + Intergenic
1197250644 X:124212994-124213016 ATTTTATTCTTCAGGGCAAAGGG - Intronic
1197637969 X:128937605-128937627 CTATTATTATTATGTGCACATGG + Intergenic
1197869260 X:131050226-131050248 ATTTCCTTATTAGGGGCAAAAGG + Intergenic
1199369103 X:147024320-147024342 ATATCAATATTAAAGGAAAATGG + Intergenic
1199998403 X:153042186-153042208 ATATTATTAATAACAGTAAATGG + Intergenic
1200360969 X:155605745-155605767 ATATTAATCTTAAGTGTAAATGG + Intronic
1200515857 Y:4142963-4142985 AAATTATTGTGAAAGGCAAAGGG - Intergenic
1200877083 Y:8168415-8168437 ATTTTATTTTTAGAGGCAAATGG + Intergenic
1200949628 Y:8882225-8882247 ATATTATTTTAAAGGGAACAAGG - Intergenic
1201056611 Y:9999333-9999355 ATATTATTTTTAGAGCCAAATGG - Intergenic
1202068669 Y:20967934-20967956 ATATTATGCATAAGGGCAATGGG + Intergenic