ID: 906718529

View in Genome Browser
Species Human (GRCh38)
Location 1:47988426-47988448
Sequence CACAACACAGTGAGGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906718525_906718529 -7 Left 906718525 1:47988410-47988432 CCAGACCCTTCACTGGCACAACA 0: 1
1: 0
2: 1
3: 6
4: 135
Right 906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
906718524_906718529 -6 Left 906718524 1:47988409-47988431 CCCAGACCCTTCACTGGCACAAC 0: 1
1: 0
2: 0
3: 9
4: 186
Right 906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906718529 Original CRISPR CACAACACAGTGAGGTGCTC TGG Intronic
900324961 1:2104209-2104231 CACATCCCAGTGAGGTGATGAGG - Intronic
902291495 1:15438450-15438472 CCCAACATGGTTAGGTGCTCAGG - Exonic
902877661 1:19350432-19350454 CACAGCACAGTGTGGTGACCAGG - Intronic
902882227 1:19379970-19379992 CACATCACAATGATGTGGTCAGG - Intronic
905107873 1:35574755-35574777 CACTGCACAGTGAGATGCCCAGG + Intronic
905210487 1:36370621-36370643 CACCACCCAGAGAGGTGCGCAGG - Intronic
906718529 1:47988426-47988448 CACAACACAGTGAGGTGCTCTGG + Intronic
908351936 1:63294590-63294612 CACAACACAGAGAGGCTTTCAGG - Intergenic
912550299 1:110481005-110481027 CACCACACTGTGAAGTGCTGGGG - Intergenic
915904432 1:159867503-159867525 CTGATCCCAGTGAGGTGCTCTGG - Intronic
916288316 1:163135376-163135398 TATAACACAGTGAGGTGATGAGG - Intronic
916374093 1:164132872-164132894 AACAACACAGTATGGTGCTGTGG + Intergenic
917895625 1:179484430-179484452 CACAAGACAGGGGGGTGCTCAGG - Intronic
920128722 1:203714134-203714156 CACACCACAGTGAGCTTTTCTGG - Intronic
921960171 1:221026093-221026115 CACAACTCAGTGAGCTCCCCTGG - Intergenic
1064345856 10:14532299-14532321 CATAACACGGGGAGGTGCTGGGG - Intronic
1065597458 10:27328941-27328963 CACAAGACTGAGAGTTGCTCTGG - Intergenic
1067804781 10:49385098-49385120 CAAGACACAGTGGGCTGCTCAGG - Intronic
1068946550 10:62735297-62735319 CACAGCACAGTGAGGTGAGTAGG - Intergenic
1069071952 10:63998438-63998460 CAGGACAGACTGAGGTGCTCTGG + Intergenic
1070799243 10:79235387-79235409 CAGAGCACACCGAGGTGCTCGGG + Intronic
1070916162 10:80156262-80156284 CGCAACACAGTGTCCTGCTCAGG + Intronic
1072215044 10:93280836-93280858 ATCAACACAGTGGGGTGCTCGGG - Intergenic
1073602821 10:104863554-104863576 TACAACACAGCCAGGTGCTATGG - Intronic
1075953692 10:126504550-126504572 CACAACCCAGTGTGGGCCTCGGG + Exonic
1076070621 10:127485387-127485409 CACTACTCAGTGACGTGCACGGG - Intergenic
1076787346 10:132757860-132757882 CACAACACAGTGCCGTGGTGTGG + Intronic
1076787387 10:132758012-132758034 CACAACACAGTGCCGTGGTGTGG + Intronic
1076787510 10:132758404-132758426 CACAACACAGTGCCGTGGTGTGG + Intronic
1078624045 11:12937320-12937342 CACCACACAGGGTGGTGCCCTGG + Exonic
1079975361 11:27084145-27084167 GAAAAGACACTGAGGTGCTCAGG - Intronic
1083538953 11:63498302-63498324 CACCACAGGGTGAAGTGCTCTGG - Intergenic
1084968406 11:72756272-72756294 CCCAACACAATGAGGTGCCGGGG + Intronic
1085450367 11:76628647-76628669 CCCAACACAGTGAGGTAACCGGG - Intergenic
1085460670 11:76691328-76691350 AACAATACAGGAAGGTGCTCAGG + Intergenic
1090374183 11:126277403-126277425 CACAAAACACTGGGGTTCTCGGG - Intronic
1090380811 11:126326364-126326386 CACAGCCCCGTGTGGTGCTCAGG - Intronic
1092835423 12:12483590-12483612 CACAACATAGGGAGGTGATTAGG - Intronic
1097022448 12:56029931-56029953 AACTACACAGTGAGGTGAACTGG + Intronic
1101724316 12:107376481-107376503 CACAACACTGTGAGGTGTTAGGG - Intronic
1101724799 12:107379931-107379953 CACAACACTGTGAGGTGTTGGGG - Intronic
1102184041 12:110934002-110934024 CACAGCACAGAGAGTTGTTCAGG - Intergenic
1104202842 12:126608709-126608731 CTCAACACAGAGAGATGCTAGGG - Intergenic
1104400515 12:128472325-128472347 CACAAGACAGGAAGGTTCTCTGG - Intronic
1104628745 12:130381297-130381319 CACAGCACAGGGAGGTGTTAGGG - Intergenic
1104946238 12:132416050-132416072 CAGAGCTCAGTGAGGTGCCCTGG + Intergenic
1106780411 13:33053580-33053602 CACCCCACAGTGAGGTGCTACGG - Intronic
1110666095 13:78118950-78118972 CACAACACAGGGAAGACCTCAGG + Intergenic
1110849818 13:80232352-80232374 TACATCACAGTCAGGAGCTCTGG + Intergenic
1111787567 13:92809403-92809425 CACAATTCAGTGAGGTGCAGAGG + Intronic
1113350196 13:109521974-109521996 AAGAAAACTGTGAGGTGCTCCGG - Intergenic
1113858021 13:113460002-113460024 CACAAGAGCGTGAGGTTCTCTGG + Intronic
1116380792 14:44265180-44265202 CAGAACACTGTGAGGGGCACAGG + Intergenic
1116731005 14:48622629-48622651 AACAACACAGTTTGCTGCTCAGG + Intergenic
1118709705 14:68509236-68509258 GACAACCCAGTGAAGGGCTCAGG - Intronic
1120747314 14:88164119-88164141 CACTAGACAGTGAGGTCCTTTGG + Intergenic
1123187096 14:106530605-106530627 CAGAACACCAGGAGGTGCTCAGG - Intergenic
1123203615 14:106691756-106691778 CAAGACACAGTGGGATGCTCAGG - Intergenic
1125826101 15:42677891-42677913 CACAACACCATGATGTACTCTGG - Intronic
1126734720 15:51719177-51719199 CACAACCCTGTGAGATGTTCAGG - Intronic
1131887416 15:96932027-96932049 CACAATACAGTCAGATCCTCCGG + Intergenic
1131992153 15:98103045-98103067 CCAAACACAATGAGGAGCTCCGG + Intergenic
1132098509 15:99005951-99005973 CCAAACACAATGAGGGGCTCTGG - Intronic
1134789765 16:16978985-16979007 GACAAGACAGTGATGTTCTCTGG + Intergenic
1135511888 16:23092432-23092454 CACCACACTGTGAAGTTCTCTGG - Intronic
1137936467 16:52639539-52639561 AATAACACAGAGAGGTGATCAGG - Intergenic
1138573663 16:57892496-57892518 CACAAGACACTGAGGTCCCCTGG - Intronic
1139354813 16:66361177-66361199 CACACCACACTGAGGAGCTCAGG - Intergenic
1140215467 16:73003798-73003820 CAGAACAGAGTGAGGGGGTCAGG + Intronic
1141818604 16:86430008-86430030 CACAACAAAGGGAGGTGCATAGG + Intergenic
1142138558 16:88462471-88462493 CACAGCACACAGTGGTGCTCTGG + Intronic
1142165963 16:88588286-88588308 CCCATCACAGTGCAGTGCTCTGG + Intronic
1145689474 17:26722935-26722957 CAGAGGACAGTGAGGTGGTCAGG + Intergenic
1153046240 18:857783-857805 CACAACAAAGTCAGCTGCTAAGG + Intergenic
1155177605 18:23314354-23314376 GACCACACAGTGAGATGCACTGG - Intronic
1158543083 18:58374474-58374496 CACAACACAGTGGGGTGGGGAGG - Intronic
1158964666 18:62612012-62612034 CACAACACAGGGTGTTGCTGGGG + Intergenic
1160423468 18:78765172-78765194 CACACCCCAGAGAGATGCTCTGG + Intergenic
1163757850 19:19117313-19117335 CTCAACACCGTGTGGTGCCCAGG - Intergenic
1164773010 19:30826891-30826913 AACACCACTGTGAGATGCTCAGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
925314733 2:2912745-2912767 CACAGCACAGTGCGATGTTCTGG - Intergenic
925455398 2:4012276-4012298 CACAGCCCAGTGAGGAGCTTGGG + Intergenic
927985746 2:27409379-27409401 CCCAACACGGTGAAGTGCTCCGG - Exonic
929715584 2:44306039-44306061 CACCTCACACGGAGGTGCTCAGG + Intronic
929752291 2:44728211-44728233 CACAAAACAGCCAGGTGCACTGG - Intronic
930881087 2:56271447-56271469 CACAAGACAGGGAGCAGCTCTGG - Intronic
932360139 2:71098099-71098121 CAGCCCACAGTGAGGAGCTCAGG - Intergenic
934950738 2:98573662-98573684 CACTTCAGAGTGAGCTGCTCAGG - Intronic
935837843 2:107074834-107074856 CACACCACAGTCAGGAGCACAGG - Intergenic
937551306 2:123095585-123095607 CACACAACAGTGCTGTGCTCAGG - Intergenic
938120728 2:128631401-128631423 CACACGAGAATGAGGTGCTCAGG - Intergenic
942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG + Intergenic
942795986 2:179819617-179819639 CAGAACACTGTGAGGTGCTCAGG + Intronic
943255159 2:185585287-185585309 CAAAACAAAGGGATGTGCTCTGG + Intergenic
944879701 2:203999915-203999937 CAGAAGGCAGTTAGGTGCTCTGG + Intergenic
946373084 2:219292296-219292318 CACAACTCAGTGAGGAGCAGGGG + Intronic
947995288 2:234522444-234522466 CCCAAGACAGTGTGGAGCTCTGG + Intergenic
1169508649 20:6240487-6240509 CACACAGCAGTGCGGTGCTCAGG - Intergenic
1170802529 20:19602230-19602252 AACAACAAAGTGCGGTGCCCAGG - Intronic
1171954937 20:31454492-31454514 CAGTAGACAGTGAGGTGTTCTGG + Intergenic
1173070204 20:39756935-39756957 CACACCACAGTGTAGTGTTCTGG - Intergenic
1174937625 20:54889047-54889069 CACAAAACAGAGTGATGCTCCGG + Intergenic
1175400303 20:58696403-58696425 CCCAACCCAGTGAGGAGCACAGG - Intronic
1181463306 22:23097786-23097808 CAAGGCAAAGTGAGGTGCTCAGG + Intronic
1183026135 22:35067075-35067097 CAGCACACATTGAGGGGCTCAGG - Exonic
1184979339 22:48085005-48085027 GACCACACAGTCAGGTGCTGAGG + Intergenic
950802750 3:15567717-15567739 CAGAACACAGTGCTGTGCACAGG + Intronic
950854167 3:16089864-16089886 CAAACCACAGTGAGGTTTTCCGG + Intergenic
953104242 3:39860514-39860536 CAGAAGACAGGGAGGTCCTCAGG - Intronic
955634758 3:61015345-61015367 CCCACCACAGTGAGGGGCTGAGG + Intronic
956085567 3:65605883-65605905 CACAACCCAGAGAGGAGATCCGG + Intronic
956738495 3:72257128-72257150 AACAGCACAGGGAGGAGCTCTGG - Intergenic
958784119 3:98578081-98578103 CATAAGACAGTTAGGTGTTCAGG + Intronic
959827504 3:110816089-110816111 CACAACTCAGAGATGAGCTCAGG - Intergenic
960153606 3:114275536-114275558 CACAGCACAAAGAGCTGCTCAGG + Intergenic
961389722 3:126545122-126545144 GACAACACAGGGGGGTGCCCAGG + Intronic
967814983 3:193790842-193790864 TACAGGACAGAGAGGTGCTCCGG - Intergenic
969463637 4:7342262-7342284 CAGGACACAGTGAGTAGCTCAGG - Intronic
969871923 4:10110048-10110070 CAAAGAACAGAGAGGTGCTCAGG + Intronic
971727233 4:30329253-30329275 CAAACTACAGTGAGGTGCTATGG + Intergenic
971893612 4:32560263-32560285 CACAACACAGTGAGCAGAACAGG - Intergenic
975502198 4:75099618-75099640 CTCAAGGCAGTGAGGTCCTCAGG + Intergenic
975939472 4:79624987-79625009 CACAACACAGTGGAATGCTTTGG + Intergenic
976365905 4:84231745-84231767 GATAACACAGTGAGGTGGTTTGG - Intergenic
978485525 4:109249415-109249437 CCCAACACAGTTAGATGCTTGGG + Intronic
980257568 4:130402331-130402353 CACCACACTGTGAAATGCTCTGG - Intergenic
981511829 4:145566263-145566285 CACTAGACTGAGAGGTGCTCAGG - Intergenic
981778581 4:148398621-148398643 CACAGCACAGAAAGGTGCTGGGG + Intronic
986610767 5:9564961-9564983 CGCAACACAGTGAGTTGCTGGGG - Intergenic
996820646 5:127623078-127623100 CACAACACAATGAGGAGGCCAGG + Intergenic
998554997 5:143114685-143114707 CAGAACACAGGCAGGTGCTGGGG - Intronic
998950005 5:147384123-147384145 CACAACACAGTGAAGGGTCCTGG + Exonic
999694974 5:154180639-154180661 CAAAACACAGAGAGGTGGTGGGG - Intronic
1000205852 5:159057890-159057912 GACAACACAGTGAGGTAAGCAGG - Intronic
1001919852 5:175591184-175591206 CAGAGCACACTTAGGTGCTCAGG + Intergenic
1004284149 6:14305077-14305099 CCCAGCACAGAGAGATGCTCGGG - Intergenic
1005351121 6:24936815-24936837 TACAACACAGTGGAGTGCTCTGG - Intronic
1005495948 6:26388096-26388118 CTCCACACTGTGAGGGGCTCTGG - Exonic
1005990773 6:30900373-30900395 CTCAACTCAGAGGGGTGCTCTGG + Intergenic
1012148069 6:95711190-95711212 TACAACACATTAAGGTGCTTGGG + Intergenic
1012286390 6:97394279-97394301 ATCAACACATCGAGGTGCTCTGG + Intergenic
1014268790 6:119312923-119312945 TACAGCACAGTGAGGAGATCAGG + Intronic
1017524474 6:155230434-155230456 CACAACAGAGAGAGCTACTCTGG - Intronic
1019058770 6:169241199-169241221 CTGAACATAATGAGGTGCTCCGG - Intronic
1020768770 7:12360093-12360115 CAGAACACAGTGGGCTGCTAGGG - Intronic
1023287237 7:38631983-38632005 CACAGCCCAGTGAGGGGCCCTGG + Intergenic
1023764792 7:43500457-43500479 CACAGCAAAGTTAGGTCCTCAGG - Intronic
1024705107 7:51948430-51948452 CACAACAAAGTGAGGTGACCAGG + Intergenic
1027962108 7:84959145-84959167 CACAACACAGGCAGGTTCTCAGG - Intergenic
1028357378 7:89925729-89925751 CCCTACACTGTGAGCTGCTCAGG + Intergenic
1030015170 7:105211949-105211971 CAGAACTCAGTGAGGTGATCAGG - Intronic
1032076325 7:128837847-128837869 CACAGCACAGTGTGTGGCTCTGG - Intronic
1036506717 8:9363601-9363623 GACAACAAAGAGAGGGGCTCTGG + Intergenic
1037775682 8:21834059-21834081 CAAACCACAGTGAGGGGTTCTGG - Intergenic
1038219317 8:25592600-25592622 CACAACTCAGTGTGGGGCTCTGG - Intergenic
1038686100 8:29719793-29719815 CAGAACACAATGAGCTGCTCAGG - Intergenic
1041704866 8:60835853-60835875 CACAACACATTGAGGCATTCAGG - Intronic
1041854983 8:62441841-62441863 CACAACACAATGGGGTGATTTGG - Intronic
1042024876 8:64412366-64412388 AACAACATATTGAGGTGATCTGG + Intergenic
1045051214 8:98327619-98327641 CACAACACAGAGATGTGGTGGGG - Intergenic
1047210764 8:122838202-122838224 CACAGCACAGTGGGGTGCCAGGG + Intronic
1049054707 8:140226676-140226698 CACAACACATTGAGATACCCTGG + Intronic
1050276470 9:4006467-4006489 CTCAACTCAGTGATGTGCTCGGG - Intronic
1052535116 9:29736697-29736719 CACAACACAGTGAGGGTCATGGG - Intergenic
1061054698 9:128216123-128216145 CACCACACTGTGAGTTCCTCAGG + Intronic
1190624136 X:52320040-52320062 TACCTCACAGTGAGGTGCTGAGG + Intergenic
1192185658 X:68945194-68945216 CAAAAGACAGTGAGGGGCCCTGG - Intergenic
1194048262 X:89035645-89035667 CACAACCCAGAGTGGTGCTGGGG + Intergenic
1194057320 X:89151595-89151617 CACAACAAAGGGATGGGCTCTGG - Intergenic
1198810760 X:140534052-140534074 CATAACACAGTGCTGAGCTCAGG - Intergenic
1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG + Intergenic
1200303967 X:155006612-155006634 CACACCAGAGAGAGGTTCTCAGG + Intronic
1200317419 X:155148294-155148316 CACACCAGAGAGAGGTTCTCAGG - Intergenic