ID: 906719694

View in Genome Browser
Species Human (GRCh38)
Location 1:47996554-47996576
Sequence CACCCCCCGGGCGCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 224}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719694_906719704 -6 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719704 1:47996571-47996593 GGGGTGGAGGTGGAGCGGGCGGG 0: 1
1: 0
2: 9
3: 179
4: 1644
906719694_906719709 16 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719709 1:47996593-47996615 GCTAAGGTGGGTGCGGAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 138
906719694_906719703 -7 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719703 1:47996570-47996592 GGGGGTGGAGGTGGAGCGGGCGG 0: 1
1: 0
2: 27
3: 536
4: 4619
906719694_906719708 9 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719708 1:47996586-47996608 CGGGCGGGCTAAGGTGGGTGCGG 0: 1
1: 0
2: 0
3: 11
4: 154
906719694_906719705 0 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719705 1:47996577-47996599 GAGGTGGAGCGGGCGGGCTAAGG 0: 1
1: 0
2: 0
3: 17
4: 253
906719694_906719702 -10 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719702 1:47996567-47996589 CCGGGGGGTGGAGGTGGAGCGGG 0: 1
1: 0
2: 13
3: 111
4: 1123
906719694_906719707 4 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91
906719694_906719710 29 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167
906719694_906719706 3 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719706 1:47996580-47996602 GTGGAGCGGGCGGGCTAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719694 Original CRISPR CACCCCCCGGGCGCAGCCTC GGG (reversed) Intronic