ID: 906719695

View in Genome Browser
Species Human (GRCh38)
Location 1:47996555-47996577
Sequence CCACCCCCCGGGCGCAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719695_906719707 3 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91
906719695_906719705 -1 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719705 1:47996577-47996599 GAGGTGGAGCGGGCGGGCTAAGG 0: 1
1: 0
2: 0
3: 17
4: 253
906719695_906719709 15 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719709 1:47996593-47996615 GCTAAGGTGGGTGCGGAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 138
906719695_906719703 -8 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719703 1:47996570-47996592 GGGGGTGGAGGTGGAGCGGGCGG 0: 1
1: 0
2: 27
3: 536
4: 4619
906719695_906719704 -7 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719704 1:47996571-47996593 GGGGTGGAGGTGGAGCGGGCGGG 0: 1
1: 0
2: 9
3: 179
4: 1644
906719695_906719706 2 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719706 1:47996580-47996602 GTGGAGCGGGCGGGCTAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 154
906719695_906719708 8 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719708 1:47996586-47996608 CGGGCGGGCTAAGGTGGGTGCGG 0: 1
1: 0
2: 0
3: 11
4: 154
906719695_906719710 28 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719695 Original CRISPR CCACCCCCCGGGCGCAGCCT CGG (reversed) Intronic