ID: 906719699

View in Genome Browser
Species Human (GRCh38)
Location 1:47996566-47996588
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 0, 2: 2, 3: 96, 4: 915}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719699_906719706 -9 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719706 1:47996580-47996602 GTGGAGCGGGCGGGCTAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 154
906719699_906719709 4 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719709 1:47996593-47996615 GCTAAGGTGGGTGCGGAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 138
906719699_906719710 17 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167
906719699_906719708 -3 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719708 1:47996586-47996608 CGGGCGGGCTAAGGTGGGTGCGG 0: 1
1: 0
2: 0
3: 11
4: 154
906719699_906719707 -8 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91
906719699_906719712 26 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719712 1:47996615-47996637 GACCCAAACCATGGTCCCACGGG 0: 1
1: 0
2: 1
3: 13
4: 88
906719699_906719711 25 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719711 1:47996614-47996636 GGACCCAAACCATGGTCCCACGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719699 Original CRISPR CCGCTCCACCTCCACCCCCC GGG (reversed) Intronic