ID: 906719707

View in Genome Browser
Species Human (GRCh38)
Location 1:47996581-47996603
Sequence TGGAGCGGGCGGGCTAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719695_906719707 3 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91
906719701_906719707 -9 Left 906719701 1:47996567-47996589 CCGGGGGGTGGAGGTGGAGCGGG 0: 1
1: 0
2: 16
3: 92
4: 1033
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91
906719699_906719707 -8 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91
906719694_906719707 4 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719707 1:47996581-47996603 TGGAGCGGGCGGGCTAAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719707 Original CRISPR TGGAGCGGGCGGGCTAAGGT GGG Intronic