ID: 906719710

View in Genome Browser
Species Human (GRCh38)
Location 1:47996606-47996628
Sequence CGGAAGCAGGACCCAAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719695_906719710 28 Left 906719695 1:47996555-47996577 CCGAGGCTGCGCCCGGGGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167
906719694_906719710 29 Left 906719694 1:47996554-47996576 CCCGAGGCTGCGCCCGGGGGGTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167
906719699_906719710 17 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167
906719701_906719710 16 Left 906719701 1:47996567-47996589 CCGGGGGGTGGAGGTGGAGCGGG 0: 1
1: 0
2: 16
3: 92
4: 1033
Right 906719710 1:47996606-47996628 CGGAAGCAGGACCCAAACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719710 Original CRISPR CGGAAGCAGGACCCAAACCA TGG Intronic