ID: 906719711

View in Genome Browser
Species Human (GRCh38)
Location 1:47996614-47996636
Sequence GGACCCAAACCATGGTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719701_906719711 24 Left 906719701 1:47996567-47996589 CCGGGGGGTGGAGGTGGAGCGGG 0: 1
1: 0
2: 16
3: 92
4: 1033
Right 906719711 1:47996614-47996636 GGACCCAAACCATGGTCCCACGG 0: 1
1: 0
2: 0
3: 8
4: 117
906719699_906719711 25 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719711 1:47996614-47996636 GGACCCAAACCATGGTCCCACGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719711 Original CRISPR GGACCCAAACCATGGTCCCA CGG Intronic