ID: 906719712

View in Genome Browser
Species Human (GRCh38)
Location 1:47996615-47996637
Sequence GACCCAAACCATGGTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906719699_906719712 26 Left 906719699 1:47996566-47996588 CCCGGGGGGTGGAGGTGGAGCGG 0: 1
1: 0
2: 2
3: 96
4: 915
Right 906719712 1:47996615-47996637 GACCCAAACCATGGTCCCACGGG 0: 1
1: 0
2: 1
3: 13
4: 88
906719701_906719712 25 Left 906719701 1:47996567-47996589 CCGGGGGGTGGAGGTGGAGCGGG 0: 1
1: 0
2: 16
3: 92
4: 1033
Right 906719712 1:47996615-47996637 GACCCAAACCATGGTCCCACGGG 0: 1
1: 0
2: 1
3: 13
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906719712 Original CRISPR GACCCAAACCATGGTCCCAC GGG Intronic
900786418 1:4653344-4653366 GCCCCAAGCCATGGTCCTCCTGG + Intergenic
901020131 1:6251155-6251177 GACCTAAGCCAGGTTCCCACAGG - Intronic
902237502 1:15067041-15067063 GACTCAGGCCAGGGTCCCACTGG - Intronic
905518771 1:38581505-38581527 CACCCACACCAGGTTCCCACAGG + Intergenic
906719712 1:47996615-47996637 GACCCAAACCATGGTCCCACGGG + Intronic
908772481 1:67609469-67609491 GCCCCAAGCCATGGCCCAACAGG - Intergenic
911788383 1:101980041-101980063 GGCCCAAACAATGGGCCTACAGG - Intronic
917649919 1:177066225-177066247 GAGCCAGGCCATGTTCCCACTGG + Intronic
923145397 1:231194186-231194208 CACCCAAAGCATGGGCCCCCTGG - Intronic
923558318 1:235019484-235019506 GACCCAAACCCAGATCCCACCGG + Intergenic
1064600465 10:16987204-16987226 GACCGAAACAATGGTCCTTCTGG + Intronic
1068286511 10:54944074-54944096 GACCCAAAGCATGGACCAAAAGG + Intronic
1079056171 11:17208131-17208153 GAGCCAGACCCTGGTCCCCCGGG - Intronic
1081360320 11:42169362-42169384 GGCCCAAACCACAGTCACACTGG - Intergenic
1093306600 12:17528035-17528057 GTCCCACACCCTGGTCACACTGG - Intergenic
1093356296 12:18172517-18172539 GTCCAAAACCATGGTCTCCCAGG - Intronic
1096958412 12:55551077-55551099 GGCCCAAACCAGTGTCCCATTGG - Intergenic
1096994105 12:55828423-55828445 GACCCAAGCCATGGCCCCCCAGG - Exonic
1098377374 12:69831530-69831552 GAACCTATCCATAGTCCCACAGG - Intronic
1098686228 12:73424598-73424620 GGCTCAAACCATGGTCTCAGAGG - Intergenic
1110805611 13:79750896-79750918 TAACCAAACCATGGCCCCACTGG - Intergenic
1115289176 14:31751429-31751451 GACCAAAACAATGGGGCCACAGG + Intronic
1115646028 14:35369065-35369087 GAGCCCAACCAGGATCCCACGGG - Intergenic
1120423194 14:84314428-84314450 GACACACACCATGGGACCACTGG - Intergenic
1121001708 14:90455787-90455809 CACCCTCACCCTGGTCCCACTGG - Intergenic
1132243659 15:100278768-100278790 GACCCCAATCCTGGGCCCACTGG - Intronic
1141669011 16:85481805-85481827 GCCCCAAAACATGGTCTCACAGG - Intergenic
1144445387 17:15322621-15322643 AACCCAGACCCTGCTCCCACAGG + Intronic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1147336655 17:39730364-39730386 GACCCGCACCCTGGTCCCGCGGG - Intronic
1149937394 17:60821780-60821802 GGCCCAAACGATCCTCCCACTGG + Intronic
1152198181 17:78929751-78929773 GATCCAAGCCAGGGTCCCCCAGG - Intergenic
1152365650 17:79854867-79854889 GACCCAGACCCTGGGGCCACAGG + Intergenic
1152740791 17:82017490-82017512 GGCCCACACCATGGTCCACCAGG - Intergenic
1154416237 18:14177445-14177467 GAGCCAAGCCCTGGTGCCACAGG - Intergenic
1157887168 18:51379909-51379931 GACCCAGTCAATGTTCCCACGGG - Intergenic
1161989846 19:7678424-7678446 GACCCCCACCATGACCCCACGGG - Intronic
1162797422 19:13094136-13094158 TACCCCAGCCAAGGTCCCACAGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166795473 19:45423180-45423202 AACCCACACCCTGGTCCCACAGG + Intronic
1167415558 19:49369589-49369611 GAGGCAAGCCATGGTGCCACAGG - Intronic
926743108 2:16128290-16128312 GCCACAAACCAAGGTCCCACAGG - Intergenic
927152362 2:20203344-20203366 CACCCAAACCAGGATCGCACAGG + Intronic
929765518 2:44840814-44840836 GACCCAAACCATGCTCACAGTGG + Intergenic
930223795 2:48771497-48771519 GACCCAAGCCATGCTTCCCCAGG - Intronic
930915063 2:56676776-56676798 GAACCAAACCAAGGTACCCCTGG + Intergenic
931160569 2:59685819-59685841 GCCCCAAACCAGTCTCCCACAGG - Intergenic
937078723 2:119125437-119125459 GACCCCAACCCAGGTCCCATTGG - Intergenic
937078995 2:119126915-119126937 GGCCCAAGCCATGGTCCTTCAGG + Intergenic
937218463 2:120327552-120327574 GTCCCAAAACAAGGTCGCACGGG - Intergenic
942602747 2:177658064-177658086 CACCCACACCATAGTCACACGGG + Intronic
942709107 2:178812516-178812538 GACCCAAAGTATGGTCACAGAGG - Intronic
943360914 2:186917981-186918003 GAACCAAACCATTGTACAACTGG - Intergenic
947117795 2:226790991-226791013 TACCCAAACCCTTGTCACACCGG + Intronic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1170813627 20:19694895-19694917 GAGCCAAACCAGGTTCCTACAGG + Intronic
1171395857 20:24832682-24832704 GTCCCAAGCCATAGTCCCATAGG - Intergenic
1173526361 20:43735892-43735914 GGCCCATCCCATGGTGCCACAGG - Intergenic
1176171915 20:63699928-63699950 GACCCAGGCCATGTTCCCAAAGG - Exonic
1177161623 21:17554196-17554218 GACCCTGAACCTGGTCCCACAGG - Intronic
1179665916 21:42912428-42912450 GACCCAAACAATGGCCCCTTGGG - Intronic
1179802333 21:43816810-43816832 CACCCCAACCATGGTCCCCCAGG - Intergenic
1180168272 21:46041306-46041328 GCCCCAGCCCCTGGTCCCACTGG - Intergenic
1180947598 22:19705266-19705288 GACTCAGCCCAGGGTCCCACGGG + Intergenic
1181291677 22:21799076-21799098 GATCCAGACCATGATCACACAGG - Exonic
1181305716 22:21916287-21916309 GCCCAAAACCAAGGTCCCCCAGG - Intergenic
1182126647 22:27820946-27820968 AACCCAATGCCTGGTCCCACAGG + Intergenic
1182677064 22:32047589-32047611 GACCCAAGCCATGCTCTCCCGGG + Intronic
1182696490 22:32202454-32202476 GAGGCAAATCATGGTGCCACAGG + Exonic
1183310376 22:37106518-37106540 AACCCAAGCCATGGTCCAAATGG + Intronic
1183676048 22:39299454-39299476 GCCCCATCCCTTGGTCCCACTGG + Intergenic
949841412 3:8324209-8324231 GACCCAATCCCTGGACCAACTGG + Intergenic
955563022 3:60213473-60213495 GACCCAAGTCAAGCTCCCACAGG + Intronic
964646938 3:158968777-158968799 GTCACCAACCATGGTCCCACTGG + Intronic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
970990630 4:22209378-22209400 GACTCAAAACATGGTCCCCAGGG - Intergenic
971165684 4:24180946-24180968 GACTCAAAACATGATCCCTCTGG + Intergenic
972238433 4:37161580-37161602 TACTCAAAGTATGGTCCCACTGG + Intergenic
975306720 4:72857913-72857935 GCCCAAAACAATGCTCCCACAGG + Intergenic
985517304 5:353708-353730 GACCCAGACCATCTCCCCACAGG + Exonic
987141448 5:14951122-14951144 GAGCCAGGCCATGGACCCACCGG + Intergenic
987304585 5:16625427-16625449 CACTTAAACCAGGGTCCCACAGG + Intergenic
995115441 5:108472958-108472980 CACCCACACCATGCTCCCACGGG - Intergenic
996416563 5:123217055-123217077 GACCCAAAGCATGGACTCACAGG - Intergenic
996995909 5:129696568-129696590 GACCCATGACATGGTCTCACAGG + Intronic
998719395 5:144927375-144927397 GACCCAAATCCTGGGGCCACTGG - Intergenic
998969237 5:147573453-147573475 GAGCCAAAACATGGTCCCACAGG + Intergenic
1002079590 5:176729426-176729448 GACCCAAAACATGGTTTTACTGG + Intergenic
1003984238 6:11419492-11419514 GACCCAAACCTTGGGGCCACTGG - Intergenic
1006808648 6:36805787-36805809 GCCCCAAAAGATGGTCCCAAGGG + Intronic
1033421577 7:141208884-141208906 GACACAAAACCAGGTCCCACTGG - Intronic
1034354853 7:150444048-150444070 GAGCCTAACCAGGGTCCCTCTGG - Intergenic
1037484949 8:19338423-19338445 GTCCTTAACCATGGTCCCAGAGG - Intronic
1040386176 8:46916398-46916420 GACCCACACCCTGGCCCCGCTGG - Intergenic
1042989401 8:74621722-74621744 GAGCCAAACCATGTCACCACCGG + Intronic
1054851876 9:69854784-69854806 CTGCCAAACCATGGTCCTACAGG - Intronic
1060194957 9:121617558-121617580 GACCCAAACCAGTGCCCCACAGG - Intronic
1062053952 9:134461170-134461192 GCCCCCAACCATGGAGCCACAGG - Intergenic
1189688036 X:43586378-43586400 GAATCAAACCTTGGTCCAACAGG + Intergenic
1191656606 X:63605337-63605359 GACCAAAACAAAGGTGCCACAGG - Intergenic
1197322699 X:125052191-125052213 GACAGAAAGCATGGTCCCATGGG + Intergenic
1197345395 X:125322087-125322109 GCCCCAGAACATGGTCCCCCTGG + Intergenic
1197345462 X:125322396-125322418 GCCCCAGAACATGGTCCCCCTGG + Intergenic