ID: 906723944

View in Genome Browser
Species Human (GRCh38)
Location 1:48030102-48030124
Sequence CAGGAGTGCTAGAGGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
906723944_906723950 21 Left 906723944 1:48030102-48030124 CCCCAGTGCCTCTAGCACTCCTG No data
Right 906723950 1:48030146-48030168 AATATCTTTGAATGATTGCATGG No data
906723944_906723951 26 Left 906723944 1:48030102-48030124 CCCCAGTGCCTCTAGCACTCCTG No data
Right 906723951 1:48030151-48030173 CTTTGAATGATTGCATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
906723944 Original CRISPR CAGGAGTGCTAGAGGCACTG GGG (reversed) Intergenic
No off target data available for this crispr